The Huge Entity is alive! Between 2007 - 2009 I took up residence at Space Collective . The posts there express ideas I was having between the end of huge-entity.com and the beginning of my current site, machinemachine.net (also, from the end of my MA through…

I reach into the shadows behind the screen and retrieve a small, semi-transparent plastic bucket. I dip into the bucket and fish out a human brain. I have no idea to whom the brain belonged. I can't tell if it's male or female, black or white, or, with and…

Read Part I of this piece here: The Infinity of Definition ... Creative interpretations which invoke an emergent multiplicity move meaning away from the Cartesian; the digital, allowing an analogue curve of definition to develop. According to Barthes, this…

Perspective makes the single eye the center of the visible world. Everything converges on to the eye as to the vanishing point of infinity. ~ John Berger, Ways of Seeing The perceiver's position in an architectural, or merely physical space, determines the…

The mind receives a myriad impressions - trivial, fantastic, evanescent, or engraved with the sharpness of steel. From all sides they come, an incessant shower of innumerable atoms... life is a luminous halo, a semi-transparent envelope surrounding us from…

On The Solar Anus : It is clear that the world is purely parodic, in other words, that each thing seen is the parody of another, or is the same thing in a deceptive form... all things would be visibly connected if one could discover at a single glance and in…

Boxes are plain, powerful things that govern our lives. Once boxed, other, awkwardly various items become movable, stackable, dustable, understandable, loveable and, crucially, ignorable. A boxed item sneaks into invisibility. Clearly labelled, prominently…

It's been a while since I wrote anything here: I just seem to be too busy. But then I know Danieru is too, and he still manages to post post after post. Following his lead, I have a piece about boxes nearly done, and one about novels . They're unfinished, and…

I've recently become a PODCAST addict. My iPod overflows with lectures on Quantum Theory; video talks about religion, evolution and the destruction of tribal cultures; conversations about authors, philosophers and ancient Indian mathematics. The era of…

In Praise of In Praise of Shadows My brief Wikipediations tell me that Junichirō Tanizaki was one of Japan's favourite authors of the twentieth century. I gather that he captured the tests of identity brought on by Orient's shift towards Western ways - the…

I have a terrible tendency to read several books simultaneously, causing much mental overlap and leaving the floor of my room a constant litter of half-read compendiums. At the moment, the book which has most prominently grabbed my imagination is Michael…

On Confrontation The more the universe seems comprehensible, the more it also seems pointless. But if there is no solace in the fruits of our research, there is at least some consolation in the research itself. Men and women are not content to comfort…

Where does technology end and our idea of God begin? Human beings evolved to perceive a distinction between 'ourselves' and 'our technology'. Increasingly though, our technological achievements are becoming extensions of our bodies, our identities and our…

A "data cable" made from stretched nerve cells could someday help connect computers to the human nervous system. The modified cells should form better connections with human tissue than the metal electrodes currently used for purposes such as remotely…

( ... or 'A Small Problem With a Short Answer to a Small Problem With Objective Journalism' ) The Journalist wants to communicate to his readers some facts. He does not want to taint the reality of what he describes with the personality of his description.…

According to Samuel Taylor Coleridge the aim of art is to: ...transfer from our inward nature a human interest and a semblance of truth sufficient to procure for these shadows of imagination that willing suspension of disbelief for the moment, which…

There are things which by their very nature are so dependant upon human caprice that they either exist or do not exist as soon as we desire that they should or should not exist... Humankind is almost pure potential as it emerges from the formative hand of…

German philosopher Ernst Tugendhat on religion as a need and the difficulty of satisfying it : Faust avoided Gretchen's question "Do you believe in God?" But what should someone say who refuses to avoid the question and yet isn't naive? I believe that on the…

Yuletide , Christmas , Hanukkah , Oshogatsu - a world of names for a time of year about something . A time to reflect on our heritage, our faith, our existence. A time to recognise our roots. With this in mind I have collected together a series of tools for…

Far from being extracts from the extreme end of science fiction, the idea that we may one day give sentient machines the kind of rights traditionally reserved for humans is raised in a British government-commissioned report which claims to be an extensive…

On God Is God willing to prevent evil, but not able? Then he is not Omnipotent. Is he able but not willing? Then he is malevolent. Is God both able and willing? Then whence cometh evil? Is he neither able nor willing? Then why call him God? ~ Epicurus On…

Feast your brain on these aged items, ordered from least to most old! Oldest Baby Age: 17 months 11 days Title: Baby August Description: The result of the longest recorded human gestation, Baby August was the oldest newborn ever. Oldest Human Artifact in…

Nourishment Cabril Czezlaw-Barton, my secondary school Polish teacher, had eyes bigger than his stomach. This was in part due to his larger-than-average peepers, but more due to his smaller-than-average guts. He would often show me his glass eye and when I…

"...I received from Oxford the manuscript you have examined. I lingered, naturally, on the sentence: I leave to the various futures (not to all) my garden of forking paths . Almost instantly, I understood: 'the garden of forking paths' was the chaotic novel;…

The God-Shaped Hole - Part II (Link to Part I ) by Daniel Rourke The Huge Entity There have been few great movements in favour of reason as influential as that of Galileo Galilei. In summoning the power of reason as man's faculty of authority Galileo offered…

A Huge Entity presentation on non-possible futures! Last UPDATED Wednesday, November 15th The Oxford English Dictionary defines a time-capsule as "a container used to store for posterity a selection of [entities] thought to be representative of life at a…

The God-Shaped Hole - Part I (Link to Part II ) by Daniel Rourke The Huge Entity In an alternate-future reason has won an imaginary battle over faith. The relevant mysteries composing religion have been torn from the arms of their ancient idols; the sun is…

Transformative Potential by Cliff Pickover Reality Carnival In my book Sex, Drugs, Einstein, and Elves I discuss various forms of extinction. Many humans will morph tremendously in 50 to 100 years. In a sense, this is a kind of extinction. We’ll enhance our…

Our Slumbering Super-Organism by Daniel Poynter The Hyperaware Consciousness Future generations will laugh (or cry) in contemptuous hindsight at our apathy and boredom. Why try to change the world? Why get off the couch? The individual doesn't matter…

Our Waking Dream of Progress by Dwayne M. Weber's Polar Night Fifty years from now, as fed up elephants stage last ditch assaults on human habitations, lab defector, gene modded rats sign peace treaties in shadowy, underground kingdoms built amongst aging…

The Demise of the Demagogue by Armchair Anarchist Velcro City Tourist Board In fifty year’s time, people will look back and laugh at us for a lot of reasons. Apart from the fashions (“d00d, those jeans, like WTF!!!1!1”), what gets the biggest chuckles will…

The world is too complicated. There's no way we can take it all in at once. Our brains get confused . They have to be a little creative with the truth in order to make it manageable. We have to dumb things down. Some of us more than others. That's fine. We…

WARNING: Future Dead-Ahead! Thanks Arenamontanus !

On reading Stanislaw Lem 's Solaris - a rewarding activity - it might seem that the simulacrum-based goings on can be nothing more than convolouted allegory. So far-fetched are they that one would think their existence, as far as humanity is concerned, is…

Submit to the blog! Here be endless streams of symbols given birth in waves. As the seahorse father issues forth his young - disseminating, in the process, the patterns of parenthood - so shear activity in language breaks the corollary of meaning; necessarily…

Things used to be further away in some popular sense. The world is getting smaller, and not, explained Alan Partridge, due to global warming. Technological progress has resulted in modes of transportation which can move objects like me a long way, quickly.…

I am currently reading British Philosopher John Gray's - Heresies: Against Progress and Other Illusions . I tend to be turned on by anything controversial, but throw religion into the mix, slide in a healthy dollop of political cynicism, whisk that into a…

Keep clear of the cat if you want baby girls. It sounds like the lamest of old wives' tales, but according to scientists women infected with a common cat parasite give birth to more sons than daughters. The parasite, toxoplasma, infects around 15% of Britons,…

I have a fascination with the borders of fiction and how we draw them. Here we find the relationships between author, reader and character builds the substance of each fictional world. How much does the author's knowledge reflect that of the reader's? How is…

Here Lies the Value of Truth: What, then, is truth? A mobile army of metaphors, metonyms, and anthropomorphisms—in short, a sum of human relations which have been enhanced, transposed, and embellished poetically and rhetorically, and which after long use seem…

The brain: that gathered walnut of grey matter, lodged inconspicuously in the skull cavity of each and every one of us. Peer deep enough into these zones of thought; feeling; memory; dreams and each tiny pulse of inherent beauty appears as nothing more than…

'Tis a strange place, this Limbo !--not a Place, Yet name it so ;--where Time & weary Space Fettered from flight, with night-mair sense of fleeing, Strive for their last crepuscular half-being ;-- Lank Space, and scytheless Time with branny hands Barren and…

"Cheshire Puss," she began, rather timidly... "Would you tell me, please, which way I ought to go from here?" "That depends a good deal on where you want to get to," said the Cat. "I don't much care where..." said Alice. "Then it doesn't matter which way you…

The Huge Entity Forum is now stable and ready to oil the machinery of your ideas! The only forum on the internet devoted to large ideas, enormous perspectives and tantilising realities needs your lively debate. Come and make it your second home... Current…

Ever feel as though being a single ape descended life-form leaves you at a cosmic disadvantage? What would you say if I told you you could make a real difference in this barmy universe? The planet Earth is 10 days away from its biggest encounter with…

Why is it that the United States, which has not suffered a major terrorist attack at home for more than four years, thinks it's at war, while the United Kingdom, which was hit by a major terrorist attack just a year ago, does not? The evocation of war is…

Look again at that dot. That's here. That's home. That's us. On it everyone you love, everyone you know, everyone you ever heard of, every human being who ever was, lived out their lives. The aggregate of our joy and suffering, thousands of confident…

George Dyson asks: Are we learning to manipulate life or is life learning to manipulate us? A plausible scenario for how we arrived at life as we know it is that primitive organisms were infected by self-replicating parasites, learned to adopt those…

Despite its vaunted reputation as a juggernaut of American culture, McDonald's has come to function as an ecumenical refuge for travelers of all stripes. This is not because McDonald's creates an American sense of place and culture, but because it creates a…

Ever wished yourself Godlike properties? Ever wondered what it felt like to spawn universes from the slightest ounce of your being? Well now you can, with The Random Logline Generator ! Realising mythical universes is as easy as depressing your index finger.…

The Huge Entity Forum has evolved! Care to behold internet-transmogrification as it happens ? Then prepare to take a look deep beneath the surface of The Huge Entity . Viewer discretion is advised: The Internet is Alive - A Forum Discussion : What? : The…

Pozzo: (suddenly furious.) Have you not done tormenting me with your accursed time! It's abominable! When! When! One day, is that not enough for you, one day he went dumb, one day I went blind, one day we'll go deaf, one day we were born, one day we shall…

A minority of people with autism have one or more extraordinary intellectual talents, such as the rapid ability to calculate the day of the week for a given date, or to count large numbers of discrete objects almost instantaneously - they're often called…

Next time you go for the proverbial dump consider the process involved in turning one plate of badly cooked meat and veg into a self perceiving, website reading, procrastinating you . It occurs to me that the chance of atoms, manufactured billions of years…

I have almost finished reading Cliff Pickover's demiurgic reality-guidebook ' Sex, Drugs Einstein & Elves: Sushi, Psychedelics, Parallel Universes and the Quest for Transcendence '. It's been a ride I'd recommend to anyone interested in destroying this…

In past posts I have touched on the idea that we are all the protagonists in our own reality narratives . These realities interrelate in surprising ways which either enrich or contradict our individual, subjective perspectives. In organised religion can be…

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTG TCTAGAA WHATAPIECEOFWORKISMAN AAAAGTCCTCAAGAGGTTGGTTAAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTT…

From 8th to 20th May at Phonica Records, Poland St, Soho, London, Cybersonica are running a free exhibition of contemporary sonic and audiovisual works from a range of international artists. Opening hours: 11.30am-7.30pm, Mon-Wed, 11.30am-8pm, Thurs-Sat The…

Aliens! Wide-eyed, short-statured, extraterrestrially-elongated aliens! In a universe as vast as this one (assuming you aren't one of those un-evolved creationist types) alien life of some form or other appears to be a statistical certainty. Yet, in an…

Infinity defies absolute definition. Perception of the infinite, for anything other than a mind which is itself infinitely composed, is an oxymoron. And yet, in historical conceptions of the infinite, or at least the imperceptibly extended, can be found…

Tire Tube Communication - Mama and Neighbors by Tatsumi Orimoto (1998)

The 'Other Half' is the word. The 'Other Half' is an organism. Word is an organism . The presence of the 'Other Half' a separate organism attached to your nervous system on an air of words can now be demonstrated experimentally. One of the most common…

The Excruciatingly Large Forum is ALIVE! Feed it your brain today: • Panspermia: Seeds of Change • Best Science-Fiction Novels • Cultural Semiotics • Co-evolution: shaping them as they shape us? • Request for Nudity • Music Absorbtion • Thinkers Lay Out the…

Humans like to fuck. It's a fact few of us can ignore, and even fewer of us would like to change. But, as with most activities we undertake with vigor, automation, mass production and media manipulation have turned sex into the commodity of cultures. The…

In every human brain, there are as many neurons as there are galaxies in the known universe — about 100 billion, drawn from 10,000 different cell types and woven into a three-dimensional tapestry, with threads of neural interconnections that number in the…

This was originally posted to the forum (which is really hotting up by the way). I couldn't help myself but post it again here... Behold the next stage in human evolution, as witnessed in the faster than lightening hands of one Emily Fox: You have to see this…

The ideal of 'the city' has stood as the most physically accessible representation of Utopia since the days of Plato's Republic ; the mental playground from which philosophers and writers have played with the subject of human: Plato (through Socrates)…

"There's a paradox,"said Kevin White, a geneticist at Yale. "The sequences of the genomes between humans and chimps are so similar; so the genes encoded in the two genomes are so similar to one another. Yet, you have very rapid divergence in morphology and…

The amygdala is at it again! ...Researchers used Positron Emission Tomography (PET) scans to analyze the brains of 72 healthy, right-handed adults (36 men and 36 women). The subjects were instructed to relax with their eyes closed while being scanned. When…

Dwayne M. over at Weber's Polar Night poses an interesting question today, one which has me reaching for my Baudrillard with gusto: From Wikipedia ... Colossus: The Forbin Project is an apocalyptic science fiction movie based on the 1966 novel 'Colossus' by…

Mu Haiku is back! If infamy is a viral infection then Jesus is surely the memetic common cold, clogging up the nostrils of civilisation since year nought. This guy was such a fly in the ointment of empire that simply killing him was not enough for the Roman…

In humans, intelligence develops over time. A child learns primarily from the guidance of patient adults. Without strong social--that is, cultural--inputs, even a potential wunderkind will end up a bungling bumpkin as an adult. We now have evidence that this…

...a straight identification of religion with any and every form of happiness leaves the essential peculiarity of religious happiness out. The more commonplace happinesses which we get are 'reliefs,' occasioned by our momentary escapes from evils either…

Imagination and creativity are the parts of our personal conscious lives most able to manifest themselves in the objective world around us. The variety of tools, both physical and cognitive , we use to channel those creative urges is truly astounding. The…

I have become fascinated recently by the continued simulation of our world out of existence. The word ' technology ' is usually proceeded by thoughts of mechanical machines, digital processes and automated activity, but the borders encompassing technology…

Rejoice! For the 3rd month, 14th day, 1st hour, 59 th minute, and 26th second (3.1415926) of this year has past us by.... What does it all mean? Happy π day ! At the simplest level Pi ( π ) is the ratio of the circumference of a circle to its diameter, and at…

On the Exile of Mankind The people became numerous... The god was depressed by their uproar Enil heard their noise, He exclaimed to the great gods The noise of mankind has become burdensome... - from the ancient Sumerian epic Atrahasis Having come from the…

Entities determined to be part of the human configuration: Elemental : Oxygen (65%) Carbon (18%) Hydrogen (10%) Nitrogen (3%) Calcium (1.5%) Phosphorus (1.0%) Potassium (0.35%) Sulfur (0.25%) Sodium (0.15%) Magnesium (0.05%) Other (0.70%) Anatomical :…

Philosophy is odious and obscure, Both law and physic are for petty wits; Divinity is basest of the three, Unpleasant, harsh, contemptible and vile, 'Tis magic, magic that hath ravished Mephistopheles ... - Sc. I of Dr. Faustus by Christopher Marlowe The…

I was struck today by news that a rare genetic defect seems to be turning back the evolutionary clock in humans . The similarities between people carrying the defective gene and a certain, ape-descended, politician are quite astounding. See what you think:…

The internet has become a vast system for the evolution of conceptual memes of information. Mankind's evolved tendency to relish rumour, to gravitate towards gossip becomes viral in the hyperreal communities of cyberspace. As raw information becomes the only…

The day of the Anthropomorphic - Machine has ended . Welcome to the Era of Slime - Mould - Mechanization ! Via New Scientist & The Nonist !

A Huge Entity presentation on the nature of identity... Featuring short musings from the most original minds in the blogsphere. Contents 1 2B ll ~ 2B by Cutie Programmer 2 Living in a Multiverse by Reality Carnival 3 The Tipping Point by BPS Digest /…

Mu Machinery by Daniel Rourke The Huge Entity The machinery concerned with human experience is a bundle of cells so intricate in its complexity that it took over 13 billion years for evolutionary processes to manifest its structure. We each maintain that the…

Pushbutton Automation by JK DunneIV There is a mystical “I” awakening. It is being stirred by events unseen and of uncertain origin. When it wakes up what will it be? Inexistence is a nice concept. It works in that soporific marketing kind of way because…

As 'You' Like It by Jaime Morrison The Nonist don't take this personally but your depth of sensation, though perhaps impressive echoing as it does in the enclosed space of your own mind, is stunted. comically so in fact. your five senses, on which you rely…

A Mind Program Called Ego by Thomas Herold Quantum Biocommunication Someone gave me a book from a famous Indian author entitled 'Who Cares?' . In this book Ramesh Balsekar explains the mystery around the ego and why it's all an illusion. Reading this book…

Compared to the Cosmos by Brian Hines Church of the Churchless BrianHines.com Like you, my goal every day is to make something of myself. A successful, knowing, active, loving, happy thing. The problem is, on the scale of the universe the value of each of us…

A Reflexive Everything by Daniel Poynter Hyperaware Consciousness 'You' do not exist, and you don't love Family Guy, lip syncing monkeys and free Internet porn. If you exist in the traditional Western way - dualistic and distinct from your environment/body -…

Our Baryonic Nature by Mac Tonnies Posthuman Blues Mactonnies.com Astronomers are learning that the vast majority of the universe's matter takes a form that eludes casual analysis. We've found that we're an anomaly; if there's such a thing as a "galactic…

Burden of Proof by Gerry Canavan Backwards City More Reasons Why You, The Reader, Don't Exist 1. Unitary consciousness is an illusion . As Daniel Dennett explains at length in Consciousness Explained , what you mistakenly think of as a single voice of…

The Tipping Point by Dr. Christian Jarrett Mind Hacks BPS Digest "That's not like you to behave like that!". How many times have you heard that exclamation? It's nonsensical of course, because 'you', in the sense of a consistent, predictable, reliable…

2B ll ~ 2B by Christopher Willcock Cutie Programmer The universe has no neurons. A true statement? What sigh and what groan -- what lark upon high draws this little reckoning? A universe exists and certainly a scientist within. A conceptualizing scientist --…

Living in a Multiverse by Cliff Pickover Reality Carnival Pickover.com In our own region of the universe, we've already developed computers and the ability to simulate lifelike forms using these computers and mathematical rules. I believe that one day we will…

"O, what a world of unseen visions and heard silences, this insubstantial country of the mind! What ineffable essences, these touchless rememberings and unshowable reveries! And the privacy of it all! A secret theater of speechless monologue and prevenient…

In our semantically governed, symbolic understanding of reality we often maintain that true -identity is possible, that the whirling sensations called 'you' somehow cease at the surface of your skin, all else being distinct. Of course the Buddhist conception…

"Scholars have long debated whether our native language affects how we perceive reality -- and whether speakers of different languages might therefore see the world differently. The idea that language affects perception is controversial, and results have…

Your scientific theory has been proven. A monolithic, almost incorporeal time-machine sits in your lab awaiting further attention. Trembling with the tension of 13 billion temporal years yet to travel you dial in your exact time coordinates, pack your tuna…

"The fairest thing we can experience is the mysterious. It is the fundamental emotion which stands at the cradle of true art and true science. He who knows it not and can no longer wonder, no longer feel amazement, is as good as dead, a snuffed-out candle. It…

Is the future of humanity in the hands of Russian capitalism? From the ever contemplative DunneIV : RUSSIA is planning to mine a rare fuel on the moon by 2020 with a permanent base and a heavy-cargo transport link, a Russian space official says. "We are…

Energy is motion. Decrease the amount of motion down to low enough levels and you virtually suspend reality. Thus time, at these low temperatures, begins to lose its meaning. We all perceive ourselves as composite selves projected along a future moving axis…

By all means peruse the Exploding Head links on offer today, but remain diligent dear readers: The best way to avert Cognitive Dissonance , the enemy of every discerning head-owner, is to avoid thought completely...

On Duality: "...out of strangled Utopias is born a clown, a being divided between beauty and ugliness, between light and chaos, a clown who when he looks down and sidelong is Satan himself and when he looks upward sees a buttered angel, a snail with wings." -…

Body, volume, style and shine with long-lasting power. Clonycavan Styling Gel, along with mummification in Irish peat, works together with your freshly disemboweled corpse to protect hair from the disruptive power of 2000 years of rigor-mortis. Whether the…

'String Theory' posits that our universe arises from the vibrations of tiny, infinitesimal and multi-dimensional strings of energy resonating in a higher dimension of reality. A beautiful, if complicated idea resting on the very tip of the physics…

Following recent blog trends to, often humourously, predict the coming events of 2006 I thought today was as good a day as any to revisit the visions of two of science fiction's greatest future builders. Both Arthur C. Clarke's (ACC) and Philip K. Dick's…

Next time you start reading a work of fiction try focusing your mind from this perspective. Who knows more: you or the story's protagonist? The idea of the protagonist extends beyond fiction into the 'real' world. You are the protagonist in the narrative of…

The world is a reflection, cast by the remnants of light photons scattered onto the only point where your brain makes physical contact with the outside world: your eyes. Yet with such abundance of reality mirroring humans still find the concept of reflection…

The Huge Entity has traveled, rested and been reinvigorated. Regular posting to resume again soon... For the time being please feel free to use this post as an idea banner; a concave mirror focusing your musings to a penetrating, burning spear of intensity.…

'According to a recent study, women are aroused by watching monkey sex. Sure, they're more aroused by watching human sex, but the loving habits of the bonobo are enough to bring out the primate in any civilized lady... Barbara Bartlik, a psychiatry professor…

The Singularity , The Transhuman . Words murmured from the lips of the geek elite? An entire generation of techno-babble is set to evolve from this imagined-movement's self perpetuating beliefs. Are we on the brink of a big shift in human - even planetary -…

"The available scientific evidence tends to support the view that the mystic experience is one of internal perception, an experience that can be ecstatic, profound, or therapeutic for purely internal reasons. Yet for psychological science, the problem of…

As far as conspiracy theories go, this has to be one of the most interesting I have come across: "Predictive programming works by means of the propagation of the illusion of an infallibly accurate vision of how the world is going to look in the future".…

This was too fascinating not to post... ...and too overwhelming to try and summarise: Enjoy browsing Anatomies, taken from across the ages . Catch your breath, then click for many more.... Thanks All about nothing !

"Nasa has estimated that an impact from [asteroid] Apophis, which has an outside chance of hitting the Earth in 2036, would release more than 100,000 times the energy released in the nuclear blast over Hiroshima. Thousands of square kilometres would be…

Food is fashion these days. A symbol of your 'lifestyle'; a token gesture of the kind of culture and upbringing you were formed from. We adaptable humans eat everything, even substances not considered compatible with our digestive processes are shoveled into…

According to Freud there have been three great scientific revolutions that completely re-drew the boundaries which border human reality: Copernican : Where our geocentric perspective of the cosmos was revolutionised by the concept of the human world, the…

On Imagination: Midsummer Night's Dream - Act v. Sc. 1. The poet's eye, in a fine frenzy rolling, Doth glance from heaven to earth, from earth to heaven, And as imagination bodies forth The forms of things unknown, the poet's pen Turns them to shape, and…

Words we all know at some level, but just how close to the truth are they? Metaphor, it seems, is always just a step ahead: "The University of Pavia found a brain chemical was likely to be responsible for the first flush of love. Researchers said raised…

I posted this over at Metafilter and thought it would look kind of nice here too... I changed the links here to point to past articles at The Huge Entity . Go on, reminisce a little: If the universe is a hologram and the healthy human brain a valve of…

"UC Berkeley physics professor, Raphael Bousso, is trying to break down the mysteries of the universe with a concept called the holographic principle. Physicists stumbled on the idea while studying black holes. It is a concept, which ultimately questions…

I remember many years ago someone telling me that there was a recognised term for the kind of involuntary shudder that commonly affects people at rest. You know the kind that spontaneously rocks you, just for a moment, like you are shaking off the ghoulies,…

There are some absolutely genius ideas on the hoax/sci-fi Human Upgrades website . I've always wanted to have 8 nipples... Now it's just a matter of time. What upgrade would you get? Via Linkfilter

On epileptically induced ecstasy: "There are moments, and it is only a matter of five or six seconds, when you feel the presence of the eternal harmony...a terrible thing is the frightful clearness with which it manifests itself and the rapture with which it…

Current estimated human population on Earth: 6.52 billion people Taking a rough guess that around 50% of the world's population is asleep or unconscious at any one moment this means that: Since you started reading this post roughly 2067 human years have been…

"Ideas that could further exploration in space are coming from a surprising source - animals such as ants, fish and squirrels. The future of space exploration could lie in biomimetics, where engineering meets biology. In effect, it steals nature's…

Southern Japan revels in their insect devastation. The supermarkets seem to hold host to a wide variety of poisons, traps and sprays designed to cause insects a breakdown in their existence. On a recent shopping trip there amongst the cockroach neutralisers…

If you thought religion grappled with a multitude of concepts that border on the insane , you should take a look at The Huge Entity archives sometime. Is there some sort of higher purpose behind the pulsating nonsense this blog continually erupts? What have I…

In the past year I have read a heap load of books (my job gives me a ridiculous amount of free-time) most of which were superb. And so in recognition of my affliction for thrusting information into other people's faces, here are some of my favourite quotes…

The future of technology seems bright. We live in a world where 'progress' is perceived as a defining feature of what makes humans different from the rest of the animal kingdom, but what does that word mean? Where are we moving from and what are we moving to?…

In the 17th Century early 'scientific' analysis was undertaken of the Biblical account of Noah's Ark to determine exactly how large it must have been. From this figure they calculated a precise number of animal species that could exist on the planet's surface…

I love the Mind Hacks website. Constantly updated with cutting edge, brain related topics, today being no exception... Want to get up close and personal with the base of your very own consciousness? The winning illustration from The National Science…