I reach into the shadows behind the screen and retrieve a small, semi-transparent plastic bucket. I dip into the bucket and fish out a human brain. I have no idea to whom the brain belonged. I can't tell if it's male or female, black or white, or, with and…

THE best documentary of all time is up, ready and available to view on Veoh video. Jonathan Miller's A Rough History of Disbelief explores the development of atheism as a singular mode of being, clarifying quite spectacularly the emergence of secular thought…

I've recently become a PODCAST addict. My iPod overflows with lectures on Quantum Theory; video talks about religion, evolution and the destruction of tribal cultures; conversations about authors, philosophers and ancient Indian mathematics. The era of…

In Praise of In Praise of Shadows My brief Wikipediations tell me that Junichirō Tanizaki was one of Japan's favourite authors of the twentieth century. I gather that he captured the tests of identity brought on by Orient's shift towards Western ways - the…

I have a terrible tendency to read several books simultaneously, causing much mental overlap and leaving the floor of my room a constant litter of half-read compendiums. At the moment, the book which has most prominently grabbed my imagination is Michael…

I've been meaning to do this for a while: How do you like The Huge Entity's first video ? Check out the The Blasphemy Challenge to deny some things yourself...

The thumbnail above is but a tiny portion of an awe inspiring, one Gigapixel image available to view and explore in full at Sky Factory : About 11,000 years ago a star in the constellation of Vela exploded. This bright supernova may have been visible to the…

On Confrontation The more the universe seems comprehensible, the more it also seems pointless. But if there is no solace in the fruits of our research, there is at least some consolation in the research itself. Men and women are not content to comfort…

Where does technology end and our idea of God begin? Human beings evolved to perceive a distinction between 'ourselves' and 'our technology'. Increasingly though, our technological achievements are becoming extensions of our bodies, our identities and our…

A "data cable" made from stretched nerve cells could someday help connect computers to the human nervous system. The modified cells should form better connections with human tissue than the metal electrodes currently used for purposes such as remotely…

This is quite unconventional, but I reckon some of the readers of The Huge Entity might relish the chance to apply their critical perspectives, so here goes... I am currently studying for a Masters Degree. As part of this I have written an article, which will…

German philosopher Ernst Tugendhat on religion as a need and the difficulty of satisfying it : Faust avoided Gretchen's question "Do you believe in God?" But what should someone say who refuses to avoid the question and yet isn't naive? I believe that on the…

Yuletide , Christmas , Hanukkah , Oshogatsu - a world of names for a time of year about something . A time to reflect on our heritage, our faith, our existence. A time to recognise our roots. With this in mind I have collected together a series of tools for…

Far from being extracts from the extreme end of science fiction, the idea that we may one day give sentient machines the kind of rights traditionally reserved for humans is raised in a British government-commissioned report which claims to be an extensive…

Bert Myers' hauntingly beautiful X-Ray Photography Via NotCot.org !

With giant Saturn hanging in the blackness and sheltering Cassini from the sun's blinding glare, the [Cassini-Huygens] spacecraft viewed the rings as never before, revealing previously unknown faint rings and even glimpsing its home world. This marvelous…

Feast your brain on these aged items, ordered from least to most old! Oldest Baby Age: 17 months 11 days Title: Baby August Description: The result of the longest recorded human gestation, Baby August was the oldest newborn ever. Oldest Human Artifact in…

One could - and many do - wastefully ignore wallowing, suffocating swathes of time in an effort to formulate a novel idea. Oh, how splendid it would be to be a creative! To conjure fantasies for others! To maufacture dreams for the rest! To mass-produce in…

The God-Shaped Hole - Part II (Link to Part I ) by Daniel Rourke The Huge Entity There have been few great movements in favour of reason as influential as that of Galileo Galilei. In summoning the power of reason as man's faculty of authority Galileo offered…

The God-Shaped Hole - Part I (Link to Part II ) by Daniel Rourke The Huge Entity In an alternate-future reason has won an imaginary battle over faith. The relevant mysteries composing religion have been torn from the arms of their ancient idols; the sun is…

Our Waking Dream of Progress by Dwayne M. Weber's Polar Night Fifty years from now, as fed up elephants stage last ditch assaults on human habitations, lab defector, gene modded rats sign peace treaties in shadowy, underground kingdoms built amongst aging…

The world is too complicated. There's no way we can take it all in at once. Our brains get confused . They have to be a little creative with the truth in order to make it manageable. We have to dumb things down. Some of us more than others. That's fine. We…

All this talk of climate change; of the continued abuse of hydrocarbon bonds got me thinking. How are we expected to put our oil addicted world into perspective if we haven't got a perspective on the oily substance itself? It's all very well setting targets;…

WARNING: Future Dead-Ahead! Thanks Arenamontanus !

On reading Stanislaw Lem 's Solaris - a rewarding activity - it might seem that the simulacrum-based goings on can be nothing more than convolouted allegory. So far-fetched are they that one would think their existence, as far as humanity is concerned, is…

I am currently reading British Philosopher John Gray's - Heresies: Against Progress and Other Illusions . I tend to be turned on by anything controversial, but throw religion into the mix, slide in a healthy dollop of political cynicism, whisk that into a…

Keep clear of the cat if you want baby girls. It sounds like the lamest of old wives' tales, but according to scientists women infected with a common cat parasite give birth to more sons than daughters. The parasite, toxoplasma, infects around 15% of Britons,…

The brain: that gathered walnut of grey matter, lodged inconspicuously in the skull cavity of each and every one of us. Peer deep enough into these zones of thought; feeling; memory; dreams and each tiny pulse of inherent beauty appears as nothing more than…

The Huge Entity Forum is now stable and ready to oil the machinery of your ideas! The only forum on the internet devoted to large ideas, enormous perspectives and tantilising realities needs your lively debate. Come and make it your second home... Current…

Ever feel as though being a single ape descended life-form leaves you at a cosmic disadvantage? What would you say if I told you you could make a real difference in this barmy universe? The planet Earth is 10 days away from its biggest encounter with…

Look again at that dot. That's here. That's home. That's us. On it everyone you love, everyone you know, everyone you ever heard of, every human being who ever was, lived out their lives. The aggregate of our joy and suffering, thousands of confident…

George Dyson asks: Are we learning to manipulate life or is life learning to manipulate us? A plausible scenario for how we arrived at life as we know it is that primitive organisms were infected by self-replicating parasites, learned to adopt those…

Despite its vaunted reputation as a juggernaut of American culture, McDonald's has come to function as an ecumenical refuge for travelers of all stripes. This is not because McDonald's creates an American sense of place and culture, but because it creates a…

Ever wished yourself Godlike properties? Ever wondered what it felt like to spawn universes from the slightest ounce of your being? Well now you can, with The Random Logline Generator ! Realising mythical universes is as easy as depressing your index finger.…

The Huge Entity Forum has evolved! Care to behold internet-transmogrification as it happens ? Then prepare to take a look deep beneath the surface of The Huge Entity . Viewer discretion is advised: The Internet is Alive - A Forum Discussion : What? : The…

Neuroscientists have proposed a simple explanation for the pleasure of grasping a new concept: The brain is getting its fix. The "click" of comprehension triggers a biochemical cascade that rewards the brain with a shot of natural opium-like substances, said…

Just last week, a professor at the Massachusetts Institute of Technology named Seth Lloyd published a paper in Physical Review Letters estimating how many calculations the universe could have performed since the Big Bang — 10^120 operations on 10^90 bits of…

In the past, both big and small entities have graced The Huge Entity front page. Today we will encounter the largest single object in our galactic neighbourhood - Introducing, The Sun : Now I got you slavering at the mouth for masses of hot, fiery gas, try…

A minority of people with autism have one or more extraordinary intellectual talents, such as the rapid ability to calculate the day of the week for a given date, or to count large numbers of discrete objects almost instantaneously - they're often called…

Via Metafilter!

Next time you go for the proverbial dump consider the process involved in turning one plate of badly cooked meat and veg into a self perceiving, website reading, procrastinating you . It occurs to me that the chance of atoms, manufactured billions of years…

Physical concepts are free creations of the human mind, and are not, however it may seem, uniquely determined by the external world. In our endeavour to understand reality we are somewhat like a man trying to understand the mechanism of a closed watch. He…

Today was my last working day at Kiyama Junior High School . My students of two years each wrote me a goodbye note in their very best, hard earned English. This was definitely my favourite: Dear Daniel Rourke, Thank you till now. I hope you will try hard to…

I have almost finished reading Cliff Pickover's demiurgic reality-guidebook ' Sex, Drugs Einstein & Elves: Sushi, Psychedelics, Parallel Universes and the Quest for Transcendence '. It's been a ride I'd recommend to anyone interested in destroying this…

In past posts I have touched on the idea that we are all the protagonists in our own reality narratives . These realities interrelate in surprising ways which either enrich or contradict our individual, subjective perspectives. In organised religion can be…

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTG TCTAGAA WHATAPIECEOFWORKISMAN AAAAGTCCTCAAGAGGTTGGTTAAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTT…

The universe is at least 986 billion years older than physicists thought and is probably much older still, according to a radical new theory. The revolutionary study suggests that time did not begin with the big bang 14 billion years ago. This mammoth…

Aliens! Wide-eyed, short-statured, extraterrestrially-elongated aliens! In a universe as vast as this one (assuming you aren't one of those un-evolved creationist types) alien life of some form or other appears to be a statistical certainty. Yet, in an…

Infinity defies absolute definition. Perception of the infinite, for anything other than a mind which is itself infinitely composed, is an oxymoron. And yet, in historical conceptions of the infinite, or at least the imperceptibly extended, can be found…

The Excruciatingly Large Forum is ALIVE! Feed it your brain today: • Panspermia: Seeds of Change • Best Science-Fiction Novels • Cultural Semiotics • Co-evolution: shaping them as they shape us? • Request for Nudity • Music Absorbtion • Thinkers Lay Out the…

There is a rather superb video doing the rounds, taken from Japanese kid's TV show Pitagora Suichi (ビタゴラスイッチ / Pythagoras Switch): NHK’s “Pitagora-Switch” Within our daily lives, which we go about without thinking much about the many mysteries, archetypes,…

What's the coolest way to stretch the vageries of conscious perception to their absolute limits? How about the detection of elementary particles so weakly interactive that most can pass straight through the entire planet Earth without a blip? Welcome to the…

In every human brain, there are as many neurons as there are galaxies in the known universe — about 100 billion, drawn from 10,000 different cell types and woven into a three-dimensional tapestry, with threads of neural interconnections that number in the…

"With respect to the theological view of the question. This is always painful to me. I am bewildered. I had no intention to write atheistically. But I own that I cannot see as plainly as others do, and as I should wish to do, evidence of design and…

"There's a paradox,"said Kevin White, a geneticist at Yale. "The sequences of the genomes between humans and chimps are so similar; so the genes encoded in the two genomes are so similar to one another. Yet, you have very rapid divergence in morphology and…

The amygdala is at it again! ...Researchers used Positron Emission Tomography (PET) scans to analyze the brains of 72 healthy, right-handed adults (36 men and 36 women). The subjects were instructed to relax with their eyes closed while being scanned. When…

Thanks Pruned & BLDG Blog !

Dwayne M. over at Weber's Polar Night poses an interesting question today, one which has me reaching for my Baudrillard with gusto: From Wikipedia ... Colossus: The Forbin Project is an apocalyptic science fiction movie based on the 1966 novel 'Colossus' by…

The 37th Carnival of The Godless is up at Neural Gourmet , and it's a fat one. Apart from my very own entry to the Carnival you'll find yourself wallowing in thoughts of: Distrust - Love - Prayer Free-will - Hate - Mysticism and more besides... Abstain from…

In humans, intelligence develops over time. A child learns primarily from the guidance of patient adults. Without strong social--that is, cultural--inputs, even a potential wunderkind will end up a bungling bumpkin as an adult. We now have evidence that this…

As you may have noticed, I have been messing around with the output of the site feed for a week or so now. From now on, new posts from the (invigorating) Excruciatingly Large Forum will be automatically posted to my delicious link list. In turn this will then…

Via Reality Carnival !

Imagination and creativity are the parts of our personal conscious lives most able to manifest themselves in the objective world around us. The variety of tools, both physical and cognitive , we use to channel those creative urges is truly astounding. The…

I have become fascinated recently by the continued simulation of our world out of existence. The word ' technology ' is usually proceeded by thoughts of mechanical machines, digital processes and automated activity, but the borders encompassing technology…

Rejoice! For the 3rd month, 14th day, 1st hour, 59 th minute, and 26th second (3.1415926) of this year has past us by.... What does it all mean? Happy π day ! At the simplest level Pi ( π ) is the ratio of the circumference of a circle to its diameter, and at…

In the spirit of maintaining a balanced universe here are some Excruciatingly Small Things - Fractal constellations erupting from the humble Petri-dish... Bacteria , it must be said, are simple, fascinating and make up the vast majority of the Earth's…

On the Exile of Mankind The people became numerous... The god was depressed by their uproar Enil heard their noise, He exclaimed to the great gods The noise of mankind has become burdensome... - from the ancient Sumerian epic Atrahasis Having come from the…

Entities determined to be part of the human configuration: Elemental : Oxygen (65%) Carbon (18%) Hydrogen (10%) Nitrogen (3%) Calcium (1.5%) Phosphorus (1.0%) Potassium (0.35%) Sulfur (0.25%) Sodium (0.15%) Magnesium (0.05%) Other (0.70%) Anatomical :…

In prose nor dialectic, equality you'll find, but semantic perspiration, of testosteron-ic kinds. Today's sceptical enquiries, their beauty will astound, an inner neutral wonder, in Haiku can be found. But please whilst idly glancing, debating inner…

Philosophy is odious and obscure, Both law and physic are for petty wits; Divinity is basest of the three, Unpleasant, harsh, contemptible and vile, 'Tis magic, magic that hath ravished Mephistopheles ... - Sc. I of Dr. Faustus by Christopher Marlowe The…

The giant spiral disk of stars, dust and gas is 170,000 light-years across or nearly twice the diameter of our Milky Way. The galaxy is estimated to contain at least one trillion stars. Approximately 100 billion of these stars alone might be like our Sun in…

UPDATE: The Circle has been posted: Go here... Message to sceptics: I claimed you didn't exist , Prove me wrong Thursday! Now accepting submissions to The 29th Meeting of The Skeptics' Circle . Please send me links to articles of sceptical origin, whether…

I was struck today by news that a rare genetic defect seems to be turning back the evolutionary clock in humans . The similarities between people carrying the defective gene and a certain, ape-descended, politician are quite astounding. See what you think:…

The internet has become a vast system for the evolution of conceptual memes of information. Mankind's evolved tendency to relish rumour, to gravitate towards gossip becomes viral in the hyperreal communities of cyberspace. As raw information becomes the only…

The day of the Anthropomorphic - Machine has ended . Welcome to the Era of Slime - Mould - Mechanization ! Via New Scientist & The Nonist !

A Huge Entity presentation on the nature of identity... Featuring short musings from the most original minds in the blogsphere. Contents 1 2B ll ~ 2B by Cutie Programmer 2 Living in a Multiverse by Reality Carnival 3 The Tipping Point by BPS Digest /…

Mu Machinery by Daniel Rourke The Huge Entity The machinery concerned with human experience is a bundle of cells so intricate in its complexity that it took over 13 billion years for evolutionary processes to manifest its structure. We each maintain that the…

Pushbutton Automation by JK DunneIV There is a mystical “I” awakening. It is being stirred by events unseen and of uncertain origin. When it wakes up what will it be? Inexistence is a nice concept. It works in that soporific marketing kind of way because…

As 'You' Like It by Jaime Morrison The Nonist don't take this personally but your depth of sensation, though perhaps impressive echoing as it does in the enclosed space of your own mind, is stunted. comically so in fact. your five senses, on which you rely…

A Mind Program Called Ego by Thomas Herold Quantum Biocommunication Someone gave me a book from a famous Indian author entitled 'Who Cares?' . In this book Ramesh Balsekar explains the mystery around the ego and why it's all an illusion. Reading this book…

Compared to the Cosmos by Brian Hines Church of the Churchless BrianHines.com Like you, my goal every day is to make something of myself. A successful, knowing, active, loving, happy thing. The problem is, on the scale of the universe the value of each of us…

A Reflexive Everything by Daniel Poynter Hyperaware Consciousness 'You' do not exist, and you don't love Family Guy, lip syncing monkeys and free Internet porn. If you exist in the traditional Western way - dualistic and distinct from your environment/body -…

Our Baryonic Nature by Mac Tonnies Posthuman Blues Mactonnies.com Astronomers are learning that the vast majority of the universe's matter takes a form that eludes casual analysis. We've found that we're an anomaly; if there's such a thing as a "galactic…

Burden of Proof by Gerry Canavan Backwards City More Reasons Why You, The Reader, Don't Exist 1. Unitary consciousness is an illusion . As Daniel Dennett explains at length in Consciousness Explained , what you mistakenly think of as a single voice of…

The Tipping Point by Dr. Christian Jarrett Mind Hacks BPS Digest "That's not like you to behave like that!". How many times have you heard that exclamation? It's nonsensical of course, because 'you', in the sense of a consistent, predictable, reliable…

2B ll ~ 2B by Christopher Willcock Cutie Programmer The universe has no neurons. A true statement? What sigh and what groan -- what lark upon high draws this little reckoning? A universe exists and certainly a scientist within. A conceptualizing scientist --…

Living in a Multiverse by Cliff Pickover Reality Carnival Pickover.com In our own region of the universe, we've already developed computers and the ability to simulate lifelike forms using these computers and mathematical rules. I believe that one day we will…

"O, what a world of unseen visions and heard silences, this insubstantial country of the mind! What ineffable essences, these touchless rememberings and unshowable reveries! And the privacy of it all! A secret theater of speechless monologue and prevenient…

In our semantically governed, symbolic understanding of reality we often maintain that true -identity is possible, that the whirling sensations called 'you' somehow cease at the surface of your skin, all else being distinct. Of course the Buddhist conception…

"Scholars have long debated whether our native language affects how we perceive reality -- and whether speakers of different languages might therefore see the world differently. The idea that language affects perception is controversial, and results have…

"The fairest thing we can experience is the mysterious. It is the fundamental emotion which stands at the cradle of true art and true science. He who knows it not and can no longer wonder, no longer feel amazement, is as good as dead, a snuffed-out candle. It…

Is the future of humanity in the hands of Russian capitalism? From the ever contemplative DunneIV : RUSSIA is planning to mine a rare fuel on the moon by 2020 with a permanent base and a heavy-cargo transport link, a Russian space official says. "We are…

The Earth is a Mandala , a multi-angular construct of mental space and the thing you label ' up ' is a completely arbitrary point of reference . Quit living in ' A Hemisphere ' . Triangulate your position in the icosahedral net and get with the program (baby)…

In a technologically governed world isn't it time we found a modern alternative to the reading of palms ? to weekly horoscopes ? to Bible codes ? to phrenological readings ? The time has come for pure information to have its say on the soul of mankind. As we…

Energy is motion. Decrease the amount of motion down to low enough levels and you virtually suspend reality. Thus time, at these low temperatures, begins to lose its meaning. We all perceive ourselves as composite selves projected along a future moving axis…

By all means peruse the Exploding Head links on offer today, but remain diligent dear readers: The best way to avert Cognitive Dissonance , the enemy of every discerning head-owner, is to avoid thought completely...

On Duality: "...out of strangled Utopias is born a clown, a being divided between beauty and ugliness, between light and chaos, a clown who when he looks down and sidelong is Satan himself and when he looks upward sees a buttered angel, a snail with wings." -…

Body, volume, style and shine with long-lasting power. Clonycavan Styling Gel, along with mummification in Irish peat, works together with your freshly disemboweled corpse to protect hair from the disruptive power of 2000 years of rigor-mortis. Whether the…

Vyvyan: Do you think ants go to discos? Mike: Vyvyan - it has been proved that ants are highly intelligent with a well ordered society - the last thing they'd go to would be discos. Vyvyan: Well, why's one of them wearing a silver boob tube then? The Young…

'String Theory' posits that our universe arises from the vibrations of tiny, infinitesimal and multi-dimensional strings of energy resonating in a higher dimension of reality. A beautiful, if complicated idea resting on the very tip of the physics…

Following recent blog trends to, often humourously, predict the coming events of 2006 I thought today was as good a day as any to revisit the visions of two of science fiction's greatest future builders. Both Arthur C. Clarke's (ACC) and Philip K. Dick's…

Next time you start reading a work of fiction try focusing your mind from this perspective. Who knows more: you or the story's protagonist? The idea of the protagonist extends beyond fiction into the 'real' world. You are the protagonist in the narrative of…

The world is a reflection, cast by the remnants of light photons scattered onto the only point where your brain makes physical contact with the outside world: your eyes. Yet with such abundance of reality mirroring humans still find the concept of reflection…

The Huge Entity has traveled, rested and been reinvigorated. Regular posting to resume again soon... For the time being please feel free to use this post as an idea banner; a concave mirror focusing your musings to a penetrating, burning spear of intensity.…

50 best robots ever ?! As far as fictional synthetic entities go, Wired Magazine has failed miserably to stipulate the cream of the simulacra crop. But worry not! For all simulacra shall find their existence reinvigorated right here at The Huge Entity . You…

As this year draws to a close and my first trip home in 18 months looms large ahead of me, the concept of time has been made prominent in my imagination. 2005? What does it mean? That 2005 years ago some bloke in some nonsense-scripture was allegedly born to…

'According to a recent study, women are aroused by watching monkey sex. Sure, they're more aroused by watching human sex, but the loving habits of the bonobo are enough to bring out the primate in any civilized lady... Barbara Bartlik, a psychiatry professor…

The Singularity , The Transhuman . Words murmured from the lips of the geek elite? An entire generation of techno-babble is set to evolve from this imagined-movement's self perpetuating beliefs. Are we on the brink of a big shift in human - even planetary -…

The Bible has mutated more times than the proverbial Gremlin, and yet I think there is still room for improvement. Hebrew begat Greek begat Latin begat English - and now introducing the Simplified-Chinese Bible . What happens if you translate this into…

More Godlessness?! It's all just too orgasmic, and this half-month's offering is one of the most explosive yet. Get on over to the birth place of The Carnival, Unscrewing the Inscrutable , and get reading... My recent Next Great Revolution in Reality post is…

"The available scientific evidence tends to support the view that the mystic experience is one of internal perception, an experience that can be ecstatic, profound, or therapeutic for purely internal reasons. Yet for psychological science, the problem of…

As far as conspiracy theories go, this has to be one of the most interesting I have come across: "Predictive programming works by means of the propagation of the illusion of an infallibly accurate vision of how the world is going to look in the future".…

This was too fascinating not to post... ...and too overwhelming to try and summarise: Enjoy browsing Anatomies, taken from across the ages . Catch your breath, then click for many more.... Thanks All about nothing !

"Nasa has estimated that an impact from [asteroid] Apophis, which has an outside chance of hitting the Earth in 2036, would release more than 100,000 times the energy released in the nuclear blast over Hiroshima. Thousands of square kilometres would be…

According to Freud there have been three great scientific revolutions that completely re-drew the boundaries which border human reality: Copernican : Where our geocentric perspective of the cosmos was revolutionised by the concept of the human world, the…

"The goal of Project Pterosaur is to mount an expedition to locate and bring back to the United States living specimens of pterosaurs or their fertile eggs, which will be displayed in a Pterosaur Rookery that will be the center piece of the planned Fellowship…

On Imagination: Midsummer Night's Dream - Act v. Sc. 1. The poet's eye, in a fine frenzy rolling, Doth glance from heaven to earth, from earth to heaven, And as imagination bodies forth The forms of things unknown, the poet's pen Turns them to shape, and…

Words we all know at some level, but just how close to the truth are they? Metaphor, it seems, is always just a step ahead: "The University of Pavia found a brain chemical was likely to be responsible for the first flush of love. Researchers said raised…

Inspired in part by all lists everywhere here are the top 5 books that shifted my perspective on the world, on reality, on the self: Star Maker - Olaf Stapledon Spanning over billions of years of cosmological evolution and delving Godlike into the very heart…

I posted this over at Metafilter and thought it would look kind of nice here too... I changed the links here to point to past articles at The Huge Entity . Go on, reminisce a little: If the universe is a hologram and the healthy human brain a valve of…

"UC Berkeley physics professor, Raphael Bousso, is trying to break down the mysteries of the universe with a concept called the holographic principle. Physicists stumbled on the idea while studying black holes. It is a concept, which ultimately questions…

I remember many years ago someone telling me that there was a recognised term for the kind of involuntary shudder that commonly affects people at rest. You know the kind that spontaneously rocks you, just for a moment, like you are shaking off the ghoulies,…

I've been rolling this idea around my head for a while now, it's time to connect it with something... Merz is a nonsense word coined by German artist Kurt Schwitters. Mislabeled as part of the Dada movement his addition to abstract art is frequently…

See the blackness. Feel the blackness. Be the blackness... From unraveling the fundamentals of Brownian motion to patching together new forms of reality from relativity theory, Einstein has made more physicists horny than any other person in history, and now…

Yes, it's Mu Haiku time again at The Huge Entity ! Get your brains at the ready and your contemplative consciousnesses engaged. A real nonsense splitter today: "The US state of Kansas has ruled that science classes in public schools should include the…

On epileptically induced ecstasy: "There are moments, and it is only a matter of five or six seconds, when you feel the presence of the eternal harmony...a terrible thing is the frightful clearness with which it manifests itself and the rapture with which it…

"VATICAN CITY - A Vatican cardinal said Thursday the faithful should listen to what secular modern science has to offer, warning that religion risks turning into "fundamentalism" if it ignores scientific reason. Cardinal Paul Poupard, who heads the Pontifical…

Current estimated human population on Earth: 6.52 billion people Taking a rough guess that around 50% of the world's population is asleep or unconscious at any one moment this means that: Since you started reading this post roughly 2067 human years have been…

Southern Japan revels in their insect devastation. The supermarkets seem to hold host to a wide variety of poisons, traps and sprays designed to cause insects a breakdown in their existence. On a recent shopping trip there amongst the cockroach neutralisers…

"Scientists have discovered that schizophrenia sufferers are not fooled by a visual illusion and are able to judge it more accurately than non-schizophrenic observers. The study by UCL (University College London) and King's College London suggests that in…

If you thought religion grappled with a multitude of concepts that border on the insane , you should take a look at The Huge Entity archives sometime. Is there some sort of higher purpose behind the pulsating nonsense this blog continually erupts? What have I…

Been meaning to blog this for a while... Agathidium bushi , Agathidium cheneyi , and Agathidium rumsfeldi - three recently discovered species of slime-mold beetle - got their names from obvious members of the US government in a bout of headline grabbing…

In response to the increasingly popular pursuit of offering reward money for the proof or verification of every theory/belief/idea in the cosmos I have decided to introduce the very first: Huge Entity 'Can you Prove Religious Superiority?' Competition! I will…

In the past year I have read a heap load of books (my job gives me a ridiculous amount of free-time) most of which were superb. And so in recognition of my affliction for thrusting information into other people's faces, here are some of my favourite quotes…

Japan's recent announcement to send noodles where no noodles have gone before surely means the future of noodle technology is looking bright. But what of the past? Step in, The Origin of Noodles , courtesy of the BBC: "The remains of the world's oldest…

Every night I die. Causation departs the wide eyed experience, inner motions shuffle mental chaos into a semblance of order. A flash of colours, a distant homogeny of previous selves relate in the stasis of dreams my memories and realities. Consciousness…

"According to Mr. Bernard (see diagram) our world is hollow, with the crust of the earth being 800 miles thick. There exists two openings at the North and South Pole, each hole having a circumference of 1400 miles wide. At the center of the earth is not a…

The debate on Intelligent Design vs Evolution has been flooding through the blogsphere like some cleverly conceived primeval super-goo this week. Screw what I have to say on the issue, what about the rest of the world? HAVE you ever really looked at…

In the 17th Century early 'scientific' analysis was undertaken of the Biblical account of Noah's Ark to determine exactly how large it must have been. From this figure they calculated a precise number of animal species that could exist on the planet's surface…

Intelligent Design's last chance has come: In a court of law: "The opening shots were fired on Monday in the first court trial to scrutinise the Intelligent Design movement. ID proposes that life is so complex it cannot have emerged without the guidance of an…

I love the Mind Hacks website. Constantly updated with cutting edge, brain related topics, today being no exception... Want to get up close and personal with the base of your very own consciousness? The winning illustration from The National Science…

Space might be the final frontier, but these days one is more likely to hear about new advances in food technology over men, moons and the NASA spaceships that get them there. The public seem to have lost their fascination with all things not of the terra…

The Intelligent Design debate is set to explode. It's everywhere from science magazines to religious parodies , from Encyclopedia entries to T-shirt designs . The notion that an 'Intelligent Designer' created and is maintaining the Universe and the lifeforms…

"Chinese and American people see the world differently - literally. While Americans focus on the central objects of photographs, Chinese individuals pay more attention to the image as a whole, according to psychologists at the University of Michigan, in Ann…

Browsing through online patent blog Intellectual Property Humor I happened upon two paticular ideas that I really want to see change the world. They are thus... World Changing Patent USPN 6,055,910 : Toy gas fired missile and launcher assembly "To operate the…

There is a new world religion in town and it's proponents think it could one day rival even Christianity in its popularity and explanatory power. It is thus: The Universe was created by a Flying Spaghetti Monster and all evidence pointing towards evolution…

"We present a class of curved-spacetime vacuum solutions which develop closed timelike curves at some particular moment. We then use these vacuum solutions to construct a time-machine model. The causality violation occurs inside an empty torus, which…

It's 50 years from now and your oldest son is busy trying to set up the new Quantium 8 powered home computer ( bum bum bum bum... ) without getting in a Quantum entanglement. You watch from the sidelines, not pretending for a millisecond to understand the new…

The Solar System got a little bit bigger last month when an elusive Tenth planet was discovered . Bigger and colder than Pluto it's the largest object yet found in our solar system's icy asteroid layer , the Kuiper Belt , and could well be the first in a long…

Multiple Universes, the sci-fi addicts favourite muse. Everyone knows about them, at least the vague idea, but how can scientists possibly justify their existence? Surely it's science gone bonkers? Well not entirely. It just so happens that the most…

Some positive posting today: The risks of human prosperity: and some ways to avoid them... Climate change: Human designed organisms that can convert excess C02 in the atmosphere into biopolymers and new products - link & The real benefits of Carbon Trading -…

Following from yesterday's post about the TED conference one of its members, Barry Schwartz, suggests that we all slow the **** down! "It is such a deeply embedded assumption that no one questions it, said Mr Schwartz, who explored the idea in his book, The…

Dear ID Advocates, It has come to my recent attention that Evolution has been given a new arch-enemy in the form of Intelligent Design . I got to admit, it was mighty clever of you guys to create an alternative to creationism that you could put forward as a…

How do we curb climate change and ecological implosion? According to the G8 nations preventative methods are not the key. Instead of analysing where and why we have messed up Earth's ecology and figuring out better ways to cut back it was decided this past…

UPDATE: G8 is over and so, it seems, is any prospect of a Global agreement on environmental issues: 'Global warming is a “serious long-term challenge” requiring“resolve and urgency”, declared the Group of Eight countries on Friday... ...Simon Retallack at the…

Now that the fanfare of Live 8 has subsided those crazy G8 summit members can get right down to the business of saving the world. But maybe in amongst the expensive dinners and fancy cocktails they might reflect on what is, for all intents and purposes, the…

UPDATE: The internet is awash with news of this tremendous day in human exploration. New Scientist , as always, delivers all the info in an easily digestable format. And yes, even they used my all-time favourite science-news cliche : 'However, it will take…

Following my post last week about the infinity of Pi / π , the record for reciting its infinite sequence of numbers from memory has been broken, by a Japanese mental health counsellor no less! According to the BBC News website: "Akira Haraguchi, 59, managed…

"In a special collection of articles published beginning 1 July 2005, Science Magazine and its online companion sites celebrate the journal's 125th anniversary with a look forward -- at the most compelling puzzles and questions facing scientists today." Are…

More waves today: Collapsing Quantum Wave Functions and their effects on a time traversable universe. "THE laws of physics seem to permit time travel, and with it, paradoxical situations such as the possibility that people could go back in time to prevent…

"For decades, the cognitive and neural sciences have treated mental processes as though they involved passing discrete packets of information in a strictly feed-forward fashion from one cognitive module to the next or in a string of individuated binary…

UPDATE: Ha, ha. Maybe you think I get up to a bit of religious and political tom-foolery here at The Huge Entity ? Maybe you'd have my opinionated rantings judged by the Ginger Father Himself (check the story below)? But I believe there is no need for…

Found this via BoingBoing and was touched by it's sheer beauty... A letter written to the Kansas School Board in response to their decision to teach Intelligent Design to its pupils: "I am writing you with much concern after I read of your hearing to decide…

I just had to re-post this as it was so popular last time. Enjoy (again)... As I've been ranting on about reality, perception and the human mind for the past few days I thought I'd give you a glimpse into how much of reality your brain completely makes up.…

As my regular 2 or 3 readers may know, I have recently been on a mission to blur the lines composing human perception. Reality as a construct of the brain , reality as a simulation , reality as simulacrum . Where next? Dreams: everyone has them, everyone is…

In an attempt to discover exactly what 10 months in Japan can do to a gaijin's personality I have turned to the utterly unscientific Face Analyzer.com - A voyage into the unknown oracle of online face analysing software. The results are somewhat startling (…

Now this , is rather cool: "Sandia National Labs has accelerated a small plate from zero to 76,000 mph in less than a second. The speed of the thrust was a new record for Sandia's Z Machine - sometimes referred to as the fastest gun in the West. Actually the…

Following from Friday's post on scientist's attempts to build a computer model of the Universe I came upon this New Scientist post about building a computer simulation of the Human brain: "An effort to create the first computer simulation of the entire human…

"Scientists have recreated a vast segment of the universe inside a computer and written a brief history of time, black holes and galaxy formation. The Millennium Simulation - the biggest exercise of its kind - required 25 million megabytes of memory. But it…

Back from the brink... Today, since my entire body feels as if it has been surgically removed and replaced with a box of horse shit I thought I'd save the world of internet surfing for all you lovely folk. Here are some interesting links for you to check out:…

"An article published in the latest issue of Diplomatic History examines Bush’s post 9/11 national security strategy in a historical perspective. In doing so, author Melvyn P. Leffler finds that there is nothing new or revolutionary about the Bush…

Yes. I travel North today. First to Osaka, then Aichi for the World Science Expo 2005, and then Kobe for a bloody JET conference. May my trip bring many photos of huge, bad ass robots. Watch this space!

With all the uproar about religion & state, atheism & creationism, darwinism & design going on at the moment I thought I'd bring attention to what is one of my biggest sore points... Religion! Yeah that's right. Religion as a whole. That majority of…

"Radar has helped resolve a long-standing controversy about the purpose of a strange dance performed by bees, Nature magazine reports. The famous "waggle" dance contains information about the whereabouts of nectar, just as was originally proposed in the…

Following on from yesterday's story on political and religious ignorance here are two related stories from Slate (online news source): Creationism vs. Intelligent Design: Is there a difference? - Link Conservatism As Pathology: Are Bush supporters literally…

"Experts have dated the UK's oldest rock art, at Creswell Crags in the midlands, to more than 12,800 years ago... The complex of caves at Creswell Crags has preserved evidence of human activity during the last Ice Age. " "The man in charge of the Hubble space…

True perceived reality is a nonsense. In this mass produced, mass perceived world we inhabit one is often brought to the deceptive conclusion that we live on the brink of some progressive, maybe final understanding; a wave of truth about to sweep our modern…

Theological issues burning your inner soul? Questioning your existence leave you overcome with thorough spiritual confusion? Well try out The God FAQ , it hopefully should answer any question you might have on that most reputedly inaccessible of impossibly…

Our universe is the music resonating on tiny strings of energy composed of 10 spacial dimensions floating through 11 dimensional hyperspace. At least, that's what String Theory says it is, the most infamous and often elusive theory of modern physics. Of…

Run on over and check out this half-month's Carnival of the Godless , at Rational Being . My blasphemy themed Mu Haiku post was featured there, amongst a whole host of other sceptical and godless articles. It's definitely worth a read, topics ranging from…