A short clip from the wonder that is Gummo (1997)

Sumptuous words, winding their cacophonic symphony down a symmetrical pair of ear canals - a surging rush of compressed air incites its violent pressure upon your ear drums. Here is where the symbols of language begin their emergence, feeling with sensual…

The mind receives a myriad impressions - trivial, fantastic, evanescent, or engraved with the sharpness of steel. From all sides they come, an incessant shower of innumerable atoms... life is a luminous halo, a semi-transparent envelope surrounding us from…

I am a box. I’m not joking! And not just any box, but a regular cuboid of 103cm along each side. I am made of wood. Not just any wood, but cheap, medium density fibreboard. Prone to splinters and easily damaged, it has made living my life as an ordinary…

Impending wars, ongoing wars, wounds still bleeding from previous wars. Figurative wars - on terror, drugs, guns, crime in general. It is, very genuinely, heart-warming to see that even in such times as these, there is not enough pure evil on Earth to hold…

A "data cable" made from stretched nerve cells could someday help connect computers to the human nervous system. The modified cells should form better connections with human tissue than the metal electrodes currently used for purposes such as remotely…

The Manipulator Photography by Jill Greenberg

( ... or 'A Small Problem With a Short Answer to a Small Problem With Objective Journalism' ) The Journalist wants to communicate to his readers some facts. He does not want to taint the reality of what he describes with the personality of his description.…

Yuletide , Christmas , Hanukkah , Oshogatsu - a world of names for a time of year about something . A time to reflect on our heritage, our faith, our existence. A time to recognise our roots. With this in mind I have collected together a series of tools for…

On God Is God willing to prevent evil, but not able? Then he is not Omnipotent. Is he able but not willing? Then he is malevolent. Is God both able and willing? Then whence cometh evil? Is he neither able nor willing? Then why call him God? ~ Epicurus On…

Feast your brain on these aged items, ordered from least to most old! Oldest Baby Age: 17 months 11 days Title: Baby August Description: The result of the longest recorded human gestation, Baby August was the oldest newborn ever. Oldest Human Artifact in…

Nourishment Cabril Czezlaw-Barton, my secondary school Polish teacher, had eyes bigger than his stomach. This was in part due to his larger-than-average peepers, but more due to his smaller-than-average guts. He would often show me his glass eye and when I…

The Father of beatnik, William Burroughs, devised a technique by which one's writing may be cleansed of its cultural and semantic bias. This technique has since been known as The Cut-Up . As Burroughs himself commented: All writing is in fact cut-ups. A…

When Shrigley 's art strikes home, it does so by being believable, operating on a cusp between humour and horror, being in its way truthful, or at least plausible. His humour often relies on the unfunny, the bleak and deflated, the abject. What if someone's…

One could - and many do - wastefully ignore wallowing, suffocating swathes of time in an effort to formulate a novel idea. Oh, how splendid it would be to be a creative! To conjure fantasies for others! To maufacture dreams for the rest! To mass-produce in…

Panique au Village est une animation en stop motion (image par image). C'est l'histoire d'un cheval, d'un cowboy et d'un indien qui passent leur temps à dormir... malgré eux. Il existe en tout 20 épisodes disponibles sur un DVD. Pour en savoir plus, visitez…

A Huge Entity presentation on non-possible futures! Last UPDATED Wednesday, November 15th The Oxford English Dictionary defines a time-capsule as "a container used to store for posterity a selection of [entities] thought to be representative of life at a…

Transformative Potential by Cliff Pickover Reality Carnival In my book Sex, Drugs, Einstein, and Elves I discuss various forms of extinction. Many humans will morph tremendously in 50 to 100 years. In a sense, this is a kind of extinction. We’ll enhance our…

Our Slumbering Super-Organism by Daniel Poynter The Hyperaware Consciousness Future generations will laugh (or cry) in contemptuous hindsight at our apathy and boredom. Why try to change the world? Why get off the couch? The individual doesn't matter…

Our Waking Dream of Progress by Dwayne M. Weber's Polar Night Fifty years from now, as fed up elephants stage last ditch assaults on human habitations, lab defector, gene modded rats sign peace treaties in shadowy, underground kingdoms built amongst aging…

The Demise of the Demagogue by Armchair Anarchist Velcro City Tourist Board In fifty year’s time, people will look back and laugh at us for a lot of reasons. Apart from the fashions (“d00d, those jeans, like WTF!!!1!1”), what gets the biggest chuckles will…

The world is too complicated. There's no way we can take it all in at once. Our brains get confused . They have to be a little creative with the truth in order to make it manageable. We have to dumb things down. Some of us more than others. That's fine. We…

All this talk of climate change; of the continued abuse of hydrocarbon bonds got me thinking. How are we expected to put our oil addicted world into perspective if we haven't got a perspective on the oily substance itself? It's all very well setting targets;…

WARNING: Future Dead-Ahead! Thanks Arenamontanus !

On reading Stanislaw Lem 's Solaris - a rewarding activity - it might seem that the simulacrum-based goings on can be nothing more than convolouted allegory. So far-fetched are they that one would think their existence, as far as humanity is concerned, is…

As you may have noticed from the name under the last post there's a new entity in town. His name is Robokku and information regarding his existence can now be gleaned from The Huge Entity Profiles Page . A new era is upon us! (Don't expect it to make any more…

A pictorial example of North Korea's current weapons arsenal (not to scale)

There are better ways to animate your brain stem: The Huge Entity will be back soon. Can't you wait just a little longer?

Ever feel as though being a single ape descended life-form leaves you at a cosmic disadvantage? What would you say if I told you you could make a real difference in this barmy universe? The planet Earth is 10 days away from its biggest encounter with…

Despite its vaunted reputation as a juggernaut of American culture, McDonald's has come to function as an ecumenical refuge for travelers of all stripes. This is not because McDonald's creates an American sense of place and culture, but because it creates a…

Ever wished yourself Godlike properties? Ever wondered what it felt like to spawn universes from the slightest ounce of your being? Well now you can, with The Random Logline Generator ! Realising mythical universes is as easy as depressing your index finger.…

Neuroscientists have proposed a simple explanation for the pleasure of grasping a new concept: The brain is getting its fix. The "click" of comprehension triggers a biochemical cascade that rewards the brain with a shot of natural opium-like substances, said…

When Fu Hsi, a mythical leader of ancient China, had the 8 trigrams of the I-Ching revealed to him supernaturally he was unlikely to have known the significance they would play on British Ministry of Defence denials some 5,000 years later. Perhaps even you,…

Pozzo: (suddenly furious.) Have you not done tormenting me with your accursed time! It's abominable! When! When! One day, is that not enough for you, one day he went dumb, one day I went blind, one day we'll go deaf, one day we were born, one day we shall…

Hexakosioihexekontahexaphobiacs beware! The Day of the Beast is here, a once in a thousand year event. Behold the power of the sum of the squares of the first seven prime numbers! Today is the 6 th day of the 6 th month of the 6 th year (0 6 -0 6 -200 6 )…

Next time you go for the proverbial dump consider the process involved in turning one plate of badly cooked meat and veg into a self perceiving, website reading, procrastinating you . It occurs to me that the chance of atoms, manufactured billions of years…

Today was my last working day at Kiyama Junior High School . My students of two years each wrote me a goodbye note in their very best, hard earned English. This was definitely my favourite: Dear Daniel Rourke, Thank you till now. I hope you will try hard to…

Mary Magdalen's horny thighs, bore half - baked , hollywood blockbusters through which mullets would shine once more... Past post: Hitler's Other Legacy

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTG TCTAGAA WHATAPIECEOFWORKISMAN AAAAGTCCTCAAGAGGTTGGTTAAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTT…

Aliens! Wide-eyed, short-statured, extraterrestrially-elongated aliens! In a universe as vast as this one (assuming you aren't one of those un-evolved creationist types) alien life of some form or other appears to be a statistical certainty. Yet, in an…

Seems pretty obvious to me. Am I missing anything?

Tire Tube Communication - Mama and Neighbors by Tatsumi Orimoto (1998)

The Excruciatingly Large Forum is ALIVE! Feed it your brain today: • Panspermia: Seeds of Change • Best Science-Fiction Novels • Cultural Semiotics • Co-evolution: shaping them as they shape us? • Request for Nudity • Music Absorbtion • Thinkers Lay Out the…

There is a rather superb video doing the rounds, taken from Japanese kid's TV show Pitagora Suichi (ビタゴラスイッチ / Pythagoras Switch): NHK’s “Pitagora-Switch” Within our daily lives, which we go about without thinking much about the many mysteries, archetypes,…

"There's a paradox,"said Kevin White, a geneticist at Yale. "The sequences of the genomes between humans and chimps are so similar; so the genes encoded in the two genomes are so similar to one another. Yet, you have very rapid divergence in morphology and…

Judas is back ! And this time it's global news... All this talk of The Gospel of Judas has got me thinking about the hyperreal nature of the Bible. Unlike other holy books, such as the Qur'an , the Bible was in a state of evolutionary flux for hundreds of…

Mu Haiku is back! If infamy is a viral infection then Jesus is surely the memetic common cold, clogging up the nostrils of civilisation since year nought. This guy was such a fly in the ointment of empire that simply killing him was not enough for the Roman…

Via MonkeyFilter !

Coincidence ? I doubt it... Buddhist prophecy warns of history being a series of cyclical events . T'was only a matter of time before The Mop Top came back round The Wheel of Time - reincarnated atop a mysterious, slightly dopey looking, Messiah boy ... Day…

On race We're all colored, or you wouldn't be able to see anyone. On mental health The largest living land mammal is the absent mind. On perspective I think most people try to get others to see through their eyes. And if you look through enough eyes, like in…

Sorry Skinny. I don't have a wife... I'll be sure to let you know as soon as I do. Via Metafilter !

Some eye candy for you today, courtesy of Fudge Factory Comics ... Absorb it! Via Monkey Filter !

Introducing the NEW: Huge Entity Forum ! Annihilate your brain in entirely new realms of information exchange! I've been working on this for a while, hence the sense of quiet which has recently fallen over The Huge Entity . The forum is really easy to sign up…

www.huge-entity.com turns 365 days old today... Where were you when it all started? The Huge Entity rears back its shaggy maine of nonsense clod fur, cracks wide a pair of blood speckled jaws and lets the universe know its power; truly alive where once t'was…

In 1901 Gustavus Hindman Miller got to work interpreting the symbolism of ten thousand dreams . The nonsense which ensued is destined to cause you much cerebral pleasure this night. What can it all mean? Cheese : To dream of eating cheese, denotes great…

Entities determined to be part of the human configuration: Elemental : Oxygen (65%) Carbon (18%) Hydrogen (10%) Nitrogen (3%) Calcium (1.5%) Phosphorus (1.0%) Potassium (0.35%) Sulfur (0.25%) Sodium (0.15%) Magnesium (0.05%) Other (0.70%) Anatomical :…

In prose nor dialectic, equality you'll find, but semantic perspiration, of testosteron-ic kinds. Today's sceptical enquiries, their beauty will astound, an inner neutral wonder, in Haiku can be found. But please whilst idly glancing, debating inner…

UPDATE: The origins of these photos ... Source: LinkFilter.net !

I was struck today by news that a rare genetic defect seems to be turning back the evolutionary clock in humans . The similarities between people carrying the defective gene and a certain, ape-descended, politician are quite astounding. See what you think:…

A Huge Entity presentation on the nature of identity... Featuring short musings from the most original minds in the blogsphere. Contents 1 2B ll ~ 2B by Cutie Programmer 2 Living in a Multiverse by Reality Carnival 3 The Tipping Point by BPS Digest /…

Mu Machinery by Daniel Rourke The Huge Entity The machinery concerned with human experience is a bundle of cells so intricate in its complexity that it took over 13 billion years for evolutionary processes to manifest its structure. We each maintain that the…

Pushbutton Automation by JK DunneIV There is a mystical “I” awakening. It is being stirred by events unseen and of uncertain origin. When it wakes up what will it be? Inexistence is a nice concept. It works in that soporific marketing kind of way because…

As 'You' Like It by Jaime Morrison The Nonist don't take this personally but your depth of sensation, though perhaps impressive echoing as it does in the enclosed space of your own mind, is stunted. comically so in fact. your five senses, on which you rely…

A Mind Program Called Ego by Thomas Herold Quantum Biocommunication Someone gave me a book from a famous Indian author entitled 'Who Cares?' . In this book Ramesh Balsekar explains the mystery around the ego and why it's all an illusion. Reading this book…

Compared to the Cosmos by Brian Hines Church of the Churchless BrianHines.com Like you, my goal every day is to make something of myself. A successful, knowing, active, loving, happy thing. The problem is, on the scale of the universe the value of each of us…

A Reflexive Everything by Daniel Poynter Hyperaware Consciousness 'You' do not exist, and you don't love Family Guy, lip syncing monkeys and free Internet porn. If you exist in the traditional Western way - dualistic and distinct from your environment/body -…

Our Baryonic Nature by Mac Tonnies Posthuman Blues Mactonnies.com Astronomers are learning that the vast majority of the universe's matter takes a form that eludes casual analysis. We've found that we're an anomaly; if there's such a thing as a "galactic…

Burden of Proof by Gerry Canavan Backwards City More Reasons Why You, The Reader, Don't Exist 1. Unitary consciousness is an illusion . As Daniel Dennett explains at length in Consciousness Explained , what you mistakenly think of as a single voice of…

The Tipping Point by Dr. Christian Jarrett Mind Hacks BPS Digest "That's not like you to behave like that!". How many times have you heard that exclamation? It's nonsensical of course, because 'you', in the sense of a consistent, predictable, reliable…

2B ll ~ 2B by Christopher Willcock Cutie Programmer The universe has no neurons. A true statement? What sigh and what groan -- what lark upon high draws this little reckoning? A universe exists and certainly a scientist within. A conceptualizing scientist --…

Living in a Multiverse by Cliff Pickover Reality Carnival Pickover.com In our own region of the universe, we've already developed computers and the ability to simulate lifelike forms using these computers and mathematical rules. I believe that one day we will…

The Huge Entity never shies away from the raw, sexual power exhibited by hermaphroditic animalia . And so today, in true excruciating form, I present to you: Penis-Fencing Flatworms There is a high probability that at least one person who reads this has been,…

Your scientific theory has been proven. A monolithic, almost incorporeal time-machine sits in your lab awaiting further attention. Trembling with the tension of 13 billion temporal years yet to travel you dial in your exact time coordinates, pack your tuna…

Hitler's fashion-sense banished small, square mustaches into cultural obscurity.

The Earth is a Mandala , a multi-angular construct of mental space and the thing you label ' up ' is a completely arbitrary point of reference . Quit living in ' A Hemisphere ' . Triangulate your position in the icosahedral net and get with the program (baby)…

In a technologically governed world isn't it time we found a modern alternative to the reading of palms ? to weekly horoscopes ? to Bible codes ? to phrenological readings ? The time has come for pure information to have its say on the soul of mankind. As we…

Thanks Mr.Truffle !

Energy is motion. Decrease the amount of motion down to low enough levels and you virtually suspend reality. Thus time, at these low temperatures, begins to lose its meaning. We all perceive ourselves as composite selves projected along a future moving axis…

By all means peruse the Exploding Head links on offer today, but remain diligent dear readers: The best way to avert Cognitive Dissonance , the enemy of every discerning head-owner, is to avoid thought completely...

Body, volume, style and shine with long-lasting power. Clonycavan Styling Gel, along with mummification in Irish peat, works together with your freshly disemboweled corpse to protect hair from the disruptive power of 2000 years of rigor-mortis. Whether the…

Vyvyan: Do you think ants go to discos? Mike: Vyvyan - it has been proved that ants are highly intelligent with a well ordered society - the last thing they'd go to would be discos. Vyvyan: Well, why's one of them wearing a silver boob tube then? The Young…

Introducing: The hilarious new primetime situation comedy, 'Ones' Synopsis: The worlds of religion and fiction are full of messiahs, prophets and cool ass saviour dudes who think that each of them was the Only chosen One . Now it's time to set the record…

From All Communist Super-Leaders Everywhere! (and The Huge Entity )

As this year draws to a close and my first trip home in 18 months looms large ahead of me, the concept of time has been made prominent in my imagination. 2005? What does it mean? That 2005 years ago some bloke in some nonsense-scripture was allegedly born to…

This has to be the best advertisment for getting to know God I have ever come across... ' "Thy rod and thy staff shall comfort me..." ~ Psalm 23 Find the true meaning of comfort... Find out what it means to be truly "touched" by God... Find out what Mary…

The Bible has mutated more times than the proverbial Gremlin, and yet I think there is still room for improvement. Hebrew begat Greek begat Latin begat English - and now introducing the Simplified-Chinese Bible . What happens if you translate this into…

More Godlessness?! It's all just too orgasmic, and this half-month's offering is one of the most explosive yet. Get on over to the birth place of The Carnival, Unscrewing the Inscrutable , and get reading... My recent Next Great Revolution in Reality post is…

"Nasa has estimated that an impact from [asteroid] Apophis, which has an outside chance of hitting the Earth in 2036, would release more than 100,000 times the energy released in the nuclear blast over Hiroshima. Thousands of square kilometres would be…

Food is fashion these days. A symbol of your 'lifestyle'; a token gesture of the kind of culture and upbringing you were formed from. We adaptable humans eat everything, even substances not considered compatible with our digestive processes are shoveled into…

"The goal of Project Pterosaur is to mount an expedition to locate and bring back to the United States living specimens of pterosaurs or their fertile eggs, which will be displayed in a Pterosaur Rookery that will be the center piece of the planned Fellowship…

Ren and Stimpy rock my world... The ASIFA-Hollywood Animation Project has added some stunning drawings to their archive, donated by the legend John Kricfalusi himself! Above is a concept sketch by the very talented Vincent Waller from his hilarious episode…

Words we all know at some level, but just how close to the truth are they? Metaphor, it seems, is always just a step ahead: "The University of Pavia found a brain chemical was likely to be responsible for the first flush of love. Researchers said raised…

Don't shy away from toilet humour. You never know when it might open doors to worlds hitherto unexplored. The Great John Toilet is one such doorway, propped open by the current human revolution in whale-sized buttocks. Has convenience gone too far? Our goal…

Links: News Story / Madeyouthink Bonus: Bush baffled by door technology

By Purchasing Online Nonsense Creates $ , you get... The realisation that your life is worth nothing unless I say it is! Confidence that my bank account is growing. The freedom to live the life I tell you to. A new self-image that expands my goals and dreams.…

It's time for evolution to gets her own back! For far too long she has waited patiently as trillion upon trillions of random mutations forced her Darwinian hand. This time mutation ain't getting a look in, 'cos this time it's personal! Inspired by this story…

"Through the British-based Catholic Truth Society, U.S. Jesuit Brother Guy Consolmagno has penned his response to what he says are questions he gets from the public "all the time" when he gives talks on his work with the Vatican Observatory. Titled…

A belated birthday celebration today for super-all-time-rather-amusing-genius author Kurt Vonnegut , who coined my all-time favourite quote: Anyone who believes in telekinesis, raise my hand. For a compendium of inspiring posts by Vonnegut go on over to…

There are some absolutely genius ideas on the hoax/sci-fi Human Upgrades website . I've always wanted to have 8 nipples... Now it's just a matter of time. What upgrade would you get? Via Linkfilter

Yes, it's Mu Haiku time again at The Huge Entity ! Get your brains at the ready and your contemplative consciousnesses engaged. A real nonsense splitter today: "The US state of Kansas has ruled that science classes in public schools should include the…

This is great. Perspective-Shift-Ahoy! "In 1741, a Danish-Norwegian missionary named Hans Egede published what became a famous account of "a most dreadful monster" that appeared off the coast of Greenland. "The case is interesting," the modern scientists…

A little light reading for you today, straight from the mouth of the wonderful wikipedia . Here are some of my favourite known and allegedly sexually active Popes from the past 2000 years... Rejoice! Sexually active popes: Pope Alexander VI (1492-1503) had a…

The Brick Testament is truly superb. And yet unlike most of the other great things in life it also has the benefit of religious education on its side. Want to run through those ten commandments again? (I mean let's face it, who doesn't forget the coveting…

The art of David Shrigley needs a good blogging from time to time... Enjoy his genius.

Time for another session of Mu poetry ... Mu is a Japanese and Chinese word regarding an absence of/in the negative. When one desires an answer, but your question makes false assumptions, the answer can only be Mu. A radical change of perspective is required…

Halloween is here, a chance to celebrate 1500 years of Pagan icons being transmogrified into popular Christian symbols of evil. To celebrate in time honoured Catholic Papal tradition The Huge Entity will issue each one of its readers with a Halloween…

Mu is a Japanese and Chinese word regarding an absence of/in the negative. When one desires an answer, but your question makes false assumptions, the answer can only be Mu. A radical change of perspective is required before the Mu can be overcome. With this…

Have your dreams turned into a 4-frame comic masterpiece by Jesse Reklaw over at his Slow Wave website. The archives are well worth a glimpse, bringing into clear focus the surreal comedy of her readers' unconscious. I only wish I remembered my dreams better,…

The oldies are always the best. Here are just a few of my favourite psychologically recognised phobias: Agateophobia: Fear of insanity Allodoxaphobia: Fear of opinions Apeirophobia: Fear of infinity Barophobia: Fear of gravity Blennophobia: Fear of slime…

Been meaning to blog this for a while... Agathidium bushi , Agathidium cheneyi , and Agathidium rumsfeldi - three recently discovered species of slime-mold beetle - got their names from obvious members of the US government in a bout of headline grabbing…

In response to the increasingly popular pursuit of offering reward money for the proof or verification of every theory/belief/idea in the cosmos I have decided to introduce the very first: Huge Entity 'Can you Prove Religious Superiority?' Competition! I will…

Absorboration is the cultural equivalent of osmosis: The diffusion of memes through semipermeable human-brains from states of low data concentration to regions of high data concentration, resulting in a potential difference across the human culture which…

Japan often throws up gorgeous surprises, as if deep under its enormous exterior there was an intention behind its insanity, but it is rare that the insanity, you and your camera all intersect in the same place, at the same instant. So today I decided to do…

"According to Mr. Bernard (see diagram) our world is hollow, with the crust of the earth being 800 miles thick. There exists two openings at the North and South Pole, each hole having a circumference of 1400 miles wide. At the center of the earth is not a…

Space might be the final frontier, but these days one is more likely to hear about new advances in food technology over men, moons and the NASA spaceships that get them there. The public seem to have lost their fascination with all things not of the terra…

"ZAGREB, Croatia - Ever wondered how a lion feels, trapped in a zoo cage? Visitors to Zagreb's zoo can find out, with two cages there set aside for humans as of Friday. The cages - which visitors will be able to enter and leave at will - are labeled "Homo…

Browsing through online patent blog Intellectual Property Humor I happened upon two paticular ideas that I really want to see change the world. They are thus... World Changing Patent USPN 6,055,910 : Toy gas fired missile and launcher assembly "To operate the…

The Huge Entity is in a constant state of flux, no more so than today as it morphs into magazine form. Thanks for this must be given to the wonders of Flickr , the online image portal. Having become addicted to its offerings in the past few days I came upon a…

There is a new world religion in town and it's proponents think it could one day rival even Christianity in its popularity and explanatory power. It is thus: The Universe was created by a Flying Spaghetti Monster and all evidence pointing towards evolution…

"Satoshi Tomoda, president of the beverage maker, said: "Children copy and mimic adults. "If you get this drink ready on such occasions as events and celebrations attended by kids, it would make the occasions even more entertaining." The Kidsbeer label…

Following The Huge Entity's fine history of blatent self promotion it should be no surprise to my readers that I'm about to do it again... Welcome to My Uncyclopedic Realm ! Where Dwarfs know your girlfriend intimately: "The name Dwarf, used mainly in regions…

Heed this advice! Neurosis is not your friend...

Here's your chance to really make a difference. Join in World Jump Day and help drive the planet Earth into a new orbit! Climate change will be halted! Day time hours extended! as you and 600 million other people aim to be several feet off the ground at the…

Wait! Some porn seems to bypass the censorship I mentioned yesterday ... I introduce The Fighting Perverts , the absolute lowest of the low in Japanese Power Rangers Fetish Porn : "Fight scenes that have no choreography whatsoever. They consist of people who…

Has it really come to this? Recent talk of climate change and environmental policy can seem dry at times. It's amazing to see how a group of activists, 30 odd years into their existence, can utilise the 'free market' and the global media network to put across…

Japan is full of porn. It's true! Take a stroll around your local convenience store whilst trying to avert your eyes from the school-girl not-so-top-shelf beauties. Hop on down to the video store, you see that curtain there dangling between the rows of old…

Tired of the old Cliche - Only In Japan ? You'll be saying it yourself in a few moments... Spotted in an Ebisu subway station : "It appears that some advertising company was asked by a Tokyo distributor to do a special ad for Christmas for the Passion of the…

Wikipedia is legendary. The free source, ever evolving online encyclopedia has changed the way people share knowledge. But, as with all good things in life, it was only a matter of time before an opposite slapped itself atop the food-chain. In this case a…

Dear ID Advocates, It has come to my recent attention that Evolution has been given a new arch-enemy in the form of Intelligent Design . I got to admit, it was mighty clever of you guys to create an alternative to creationism that you could put forward as a…

"Realistic, life­size and beautiful. Elastic flesh, luxurious fur, a cybernetic infrastructure and sexy features like no other buggering hamster in the world. If you've had wet dreams over a hamster like this, you'll know exactly what we're on about. Most…

So yesterday was Haiku day (depending on how you arrange your date yesterday was the 5th of the 7th month 2005 - 05/07/05) and I went and missed it, but it doesn't mean I can't pretend and bathe in the glory of the 5-7-5 structure we all know so well. Today's…

Click around for more ...

The Planet Earth : It's got to end sometime, [unless humans survive the next 4 billion years and manage to move the Planet Earth a safe distance from the impending doom of the ever expanding firey mass of hydrogen (the sun) which will eventually engulf the…

GEL TV : A way to smother yourself with that stereotyped brand of Japanese comic-insanity the West so craves. Does this counter cultural brain squishing actually exist on the Japanese mainland? Watch Japanese TV for more than 10 minutes without bursting into…

UPDATE: Ha, ha. Maybe you think I get up to a bit of religious and political tom-foolery here at The Huge Entity ? Maybe you'd have my opinionated rantings judged by the Ginger Father Himself (check the story below)? But I believe there is no need for…

Found this via BoingBoing and was touched by it's sheer beauty... A letter written to the Kansas School Board in response to their decision to teach Intelligent Design to its pupils: "I am writing you with much concern after I read of your hearing to decide…

This story makes fiction seem pointless... "BOSTON - On April 25, Gregory Despres arrived at the U.S.-Canadian border crossing at Calais, Maine, carrying a homemade sword, a hatchet, a knife, brass knuckles and a chain saw stained with what appeared to be…

I was browsing through some oldish keitai photos tonight and discovered this long forgotten beauty. This is an inflatable indoor bouncy castle modeled in the shape of Japanese favourite pop icon, Hello Kitty... Innocent? Joyful? Harmless fun? THOSE STOMACH…

I have recently become annoyed by the media onslaught of statistics we, as the general public, have to face on a day to day basis. It is a well rounded cliche that you can say anything you like with the right slant on the wrong statistic, but the main issue…

"A Kansas City abortionist is out of business after investigators discovered a grisly house of horrors at his clinic – with fetuses kept in Styrofoam cups in his refrigerator and one employee accusing him of microwaving one and stirring it into his lunch....…

"Preferred Photo of Ted Jesus Christ GOD at 40 years of age that is the Second Coming of Jesus Christ and is the Son of man and the Son of David and from a BLOODLINE and LINE and LINAGE and Born Again a Christian and a Nativity and NOT Coming in the sky or…

In an attempt to discover exactly what 10 months in Japan can do to a gaijin's personality I have turned to the utterly unscientific Face Analyzer.com - A voyage into the unknown oracle of online face analysing software. The results are somewhat startling (…

Now this , is rather cool: "Sandia National Labs has accelerated a small plate from zero to 76,000 mph in less than a second. The speed of the thrust was a new record for Sandia's Z Machine - sometimes referred to as the fastest gun in the West. Actually the…

"Gay Fuel is pasteurized, has a great fruit flavor, is slightly carbonated and overcomes other energy drinks’ artificial taste. With the energetic goal of creating a superior product, Gay Fuel was formulated using the highest quality ingredients, such as real…

Back from the brink... Today, since my entire body feels as if it has been surgically removed and replaced with a box of horse shit I thought I'd save the world of internet surfing for all you lovely folk. Here are some interesting links for you to check out:…

News direct from the BBC website suggests that video gaming could be about to move in a new, exciting direction, well, that's as long as the Christian gaming community have anything to do with it: "The Devil, they say, has all the best tunes. Until now he has…

"A pre-kindergartner who included God on his list of 'favorite things' has been expelled from his California school for breaching the wall between church and state. School officials say that three-year old Jacob Sapperstein can return to school next week,…

"The report from the 911 Commission sited a "lack of imagination" as a reason that the World Trade Center hijack/attack was not averted." So in November 2004 Cockeyed asked his site's readers to come up with as many 'creative' terrorist attacks as possible.…

Following recent news that UK Parliament plans to outlaw 'incitement to religious hatred' , isn't it about time that we start being more nice about religion for a change?

"The family pet can now be one of your favorite Star Wars characters! The Slave Leia pet costume includes headpiece and jumpsuit with attached arms. Pet costumes recommended for dogs only." This is by far the outright strangest thing I have ever seen. I hope…

"Recently released Health, Labor and Welfare Ministry statistics, which show 32 percent of married couples in Japan tend to be sexless, has sparked controversy over the definition of the term, rather than the figure itself... ...Of the 8,766 respondents [to a…

Tony Blair (right) and Monty Python's Conrad Poohs (left) bear a striking resemblance don't you think? Politics and comedy, completely interchangeable. Wipe that smile off your face...

Easy one on the old noggin this fine day. Point your cursors to my very newly updated Japanese School Dinners Page . Screw Jamie Oliver's British, political nipple-tweaking, these food dishes will set the very WORLD on fire with their deliciousness. 19 School…

Two superb links today. I have noticed recently a thriving online community devoted to Lego engineering projects. Everything from an A-Team Van replica to a fully working Rubic's cube have passed my gaze. Today though I found the bees knees in design. A fully…

Nurses around Japan will now be able to revel in the ability to practice their wares on a lifesize, fully poseable, Obaachan (old woman) doll. I say do with this doll what you like, but there are some inherent problems here - I just can't seem to take my eyes…

Blogging can be a dry and often inane process, especially when Japan is the subject. The weblog community is crammed to bursting with Japanophilic weblogs, especially from Gaijin authors. So it was with joy in my heart that I discovered The Japanese…

Inspired by the forthcoming Hitchhiker's Guide to the Galaxy movie, and by the simple fact that I've always had a deep rooted desire to carry out this task myself, here is a link discussing the various methods and means of Destroying the Earth . Enjoy

Jesus, you are by far my all time favourite superhero. Come back soon!

Juergen Specht has a great feature about Japanese warning signs on his site. "Japanese warning signs are very different than warning signs in other parts of the world, because they usually contain a visual and easy to understand reason why something is…