The Huge Entity is alive! Between 2007 - 2009 I took up residence at Space Collective . The posts there express ideas I was having between the end of huge-entity.com and the beginning of my current site, machinemachine.net (also, from the end of my MA through…

Due to other commitments The Huge Entity has been dormant for some time now. Hidden in The Huge Entity archives are many delights. You can find them by exploring The Random Archive Gallery! As in the examples below, whenever The Homepage is refreshed a series…

Controversial French sociologist and philosopher, Jean Baudrillard , known for his fierce criticism of consumerism and excess, has died in Paris after a long illness at the age of 77. He first attracted worldwide attention in 1991 with his book The Gulf War…

I've recently become a PODCAST addict. My iPod overflows with lectures on Quantum Theory; video talks about religion, evolution and the destruction of tribal cultures; conversations about authors, philosophers and ancient Indian mathematics. The era of…

Impending wars, ongoing wars, wounds still bleeding from previous wars. Figurative wars - on terror, drugs, guns, crime in general. It is, very genuinely, heart-warming to see that even in such times as these, there is not enough pure evil on Earth to hold…

I've been meaning to do this for a while: How do you like The Huge Entity's first video ? Check out the The Blasphemy Challenge to deny some things yourself...

A "data cable" made from stretched nerve cells could someday help connect computers to the human nervous system. The modified cells should form better connections with human tissue than the metal electrodes currently used for purposes such as remotely…

( ... or 'A Small Problem With a Short Answer to a Small Problem With Objective Journalism' ) The Journalist wants to communicate to his readers some facts. He does not want to taint the reality of what he describes with the personality of his description.…

According to Samuel Taylor Coleridge the aim of art is to: ...transfer from our inward nature a human interest and a semblance of truth sufficient to procure for these shadows of imagination that willing suspension of disbelief for the moment, which…

Yuletide , Christmas , Hanukkah , Oshogatsu - a world of names for a time of year about something . A time to reflect on our heritage, our faith, our existence. A time to recognise our roots. With this in mind I have collected together a series of tools for…

Far from being extracts from the extreme end of science fiction, the idea that we may one day give sentient machines the kind of rights traditionally reserved for humans is raised in a British government-commissioned report which claims to be an extensive…

With giant Saturn hanging in the blackness and sheltering Cassini from the sun's blinding glare, the [Cassini-Huygens] spacecraft viewed the rings as never before, revealing previously unknown faint rings and even glimpsing its home world. This marvelous…

Feast your brain on these aged items, ordered from least to most old! Oldest Baby Age: 17 months 11 days Title: Baby August Description: The result of the longest recorded human gestation, Baby August was the oldest newborn ever. Oldest Human Artifact in…

Nourishment Cabril Czezlaw-Barton, my secondary school Polish teacher, had eyes bigger than his stomach. This was in part due to his larger-than-average peepers, but more due to his smaller-than-average guts. He would often show me his glass eye and when I…

When Shrigley 's art strikes home, it does so by being believable, operating on a cusp between humour and horror, being in its way truthful, or at least plausible. His humour often relies on the unfunny, the bleak and deflated, the abject. What if someone's…

One could - and many do - wastefully ignore wallowing, suffocating swathes of time in an effort to formulate a novel idea. Oh, how splendid it would be to be a creative! To conjure fantasies for others! To maufacture dreams for the rest! To mass-produce in…

A Huge Entity presentation on non-possible futures! Last UPDATED Wednesday, November 15th The Oxford English Dictionary defines a time-capsule as "a container used to store for posterity a selection of [entities] thought to be representative of life at a…

The world is too complicated. There's no way we can take it all in at once. Our brains get confused . They have to be a little creative with the truth in order to make it manageable. We have to dumb things down. Some of us more than others. That's fine. We…

According to a poll, printed today in The Guardian UK : British voters see George Bush as a greater danger to world peace than either the North Korean leader, Kim Jong-il, or the Iranian president, Mahmoud Ahmadinejad... ...[The poll] exposes high levels of…

All this talk of climate change; of the continued abuse of hydrocarbon bonds got me thinking. How are we expected to put our oil addicted world into perspective if we haven't got a perspective on the oily substance itself? It's all very well setting targets;…

Keep clear of the cat if you want baby girls. It sounds like the lamest of old wives' tales, but according to scientists women infected with a common cat parasite give birth to more sons than daughters. The parasite, toxoplasma, infects around 15% of Britons,…

A pictorial example of North Korea's current weapons arsenal (not to scale)

The brain: that gathered walnut of grey matter, lodged inconspicuously in the skull cavity of each and every one of us. Peer deep enough into these zones of thought; feeling; memory; dreams and each tiny pulse of inherent beauty appears as nothing more than…

'Tis a strange place, this Limbo !--not a Place, Yet name it so ;--where Time & weary Space Fettered from flight, with night-mair sense of fleeing, Strive for their last crepuscular half-being ;-- Lank Space, and scytheless Time with branny hands Barren and…

"Cheshire Puss," she began, rather timidly... "Would you tell me, please, which way I ought to go from here?" "That depends a good deal on where you want to get to," said the Cat. "I don't much care where..." said Alice. "Then it doesn't matter which way you…

There are better ways to animate your brain stem: The Huge Entity will be back soon. Can't you wait just a little longer?

There are times when the capacity for change overwhelms the identity of a subject. Qualities ascribed to an entity somehow anticipate their forthcoming metamorphosis, essentially prompting their own demise; manifold idiosyncrasies mutating themselves into a…

The Huge Entity Forum is now stable and ready to oil the machinery of your ideas! The only forum on the internet devoted to large ideas, enormous perspectives and tantilising realities needs your lively debate. Come and make it your second home... Current…

Ever feel as though being a single ape descended life-form leaves you at a cosmic disadvantage? What would you say if I told you you could make a real difference in this barmy universe? The planet Earth is 10 days away from its biggest encounter with…

Why is it that the United States, which has not suffered a major terrorist attack at home for more than four years, thinks it's at war, while the United Kingdom, which was hit by a major terrorist attack just a year ago, does not? The evocation of war is…

Neuroscientists have proposed a simple explanation for the pleasure of grasping a new concept: The brain is getting its fix. The "click" of comprehension triggers a biochemical cascade that rewards the brain with a shot of natural opium-like substances, said…

In the past, both big and small entities have graced The Huge Entity front page. Today we will encounter the largest single object in our galactic neighbourhood - Introducing, The Sun : Now I got you slavering at the mouth for masses of hot, fiery gas, try…

When Fu Hsi, a mythical leader of ancient China, had the 8 trigrams of the I-Ching revealed to him supernaturally he was unlikely to have known the significance they would play on British Ministry of Defence denials some 5,000 years later. Perhaps even you,…

A minority of people with autism have one or more extraordinary intellectual talents, such as the rapid ability to calculate the day of the week for a given date, or to count large numbers of discrete objects almost instantaneously - they're often called…

Hexakosioihexekontahexaphobiacs beware! The Day of the Beast is here, a once in a thousand year event. Behold the power of the sum of the squares of the first seven prime numbers! Today is the 6 th day of the 6 th month of the 6 th year (0 6 -0 6 -200 6 )…

Mary Magdalen's horny thighs, bore half - baked , hollywood blockbusters through which mullets would shine once more... Past post: Hitler's Other Legacy

Dada is back ! True, 'twas nonsense for art's sake which first cast Dadaism at the fore-front of modern art. Today in its historical absolution from ever arising again Dadaism to me reflects the transcendent nature of 20 th Century art. Merely destroying the…

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTG TCTAGAA WHATAPIECEOFWORKISMAN AAAAGTCCTCAAGAGGTTGGTTAAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTT…

The universe is at least 986 billion years older than physicists thought and is probably much older still, according to a radical new theory. The revolutionary study suggests that time did not begin with the big bang 14 billion years ago. This mammoth…

From 8th to 20th May at Phonica Records, Poland St, Soho, London, Cybersonica are running a free exhibition of contemporary sonic and audiovisual works from a range of international artists. Opening hours: 11.30am-7.30pm, Mon-Wed, 11.30am-8pm, Thurs-Sat The…

Bush: I base a lot of my foreign policy decisions on some things that I think are true. One, I believe there's an Almighty. And, secondly, I believe one of the great gifts of the Almighty is the desire in everybody's soul, regardless of what you look like or…

The Excruciatingly Large Forum is ALIVE! Feed it your brain today: • Panspermia: Seeds of Change • Best Science-Fiction Novels • Cultural Semiotics • Co-evolution: shaping them as they shape us? • Request for Nudity • Music Absorbtion • Thinkers Lay Out the…

Humans like to fuck. It's a fact few of us can ignore, and even fewer of us would like to change. But, as with most activities we undertake with vigor, automation, mass production and media manipulation have turned sex into the commodity of cultures. The…

What's the coolest way to stretch the vageries of conscious perception to their absolute limits? How about the detection of elementary particles so weakly interactive that most can pass straight through the entire planet Earth without a blip? Welcome to the…

Wiki-failure ? Wiki-media ... Wiki-obscurity ? Wiki-totality ... Wiki-hyperbole ? Wiki-hyperreality ...

In every human brain, there are as many neurons as there are galaxies in the known universe — about 100 billion, drawn from 10,000 different cell types and woven into a three-dimensional tapestry, with threads of neural interconnections that number in the…

"There's a paradox,"said Kevin White, a geneticist at Yale. "The sequences of the genomes between humans and chimps are so similar; so the genes encoded in the two genomes are so similar to one another. Yet, you have very rapid divergence in morphology and…

Judas is back ! And this time it's global news... All this talk of The Gospel of Judas has got me thinking about the hyperreal nature of the Bible. Unlike other holy books, such as the Qur'an , the Bible was in a state of evolutionary flux for hundreds of…

The amygdala is at it again! ...Researchers used Positron Emission Tomography (PET) scans to analyze the brains of 72 healthy, right-handed adults (36 men and 36 women). The subjects were instructed to relax with their eyes closed while being scanned. When…

The 37th Carnival of The Godless is up at Neural Gourmet , and it's a fat one. Apart from my very own entry to the Carnival you'll find yourself wallowing in thoughts of: Distrust - Love - Prayer Free-will - Hate - Mysticism and more besides... Abstain from…

Mu Haiku is back! If infamy is a viral infection then Jesus is surely the memetic common cold, clogging up the nostrils of civilisation since year nought. This guy was such a fly in the ointment of empire that simply killing him was not enough for the Roman…

Coincidence ? I doubt it... Buddhist prophecy warns of history being a series of cyclical events . T'was only a matter of time before The Mop Top came back round The Wheel of Time - reincarnated atop a mysterious, slightly dopey looking, Messiah boy ... Day…

On race We're all colored, or you wouldn't be able to see anyone. On mental health The largest living land mammal is the absent mind. On perspective I think most people try to get others to see through their eyes. And if you look through enough eyes, like in…

American's increasing acceptance of religious diversity doesn't extend to those who don't believe in a god, according to a national survey by researchers in the University of Minnesota's department of sociology. From a telephone sampling of more than 2,000…

Introducing the NEW: Huge Entity Forum ! Annihilate your brain in entirely new realms of information exchange! I've been working on this for a while, hence the sense of quiet which has recently fallen over The Huge Entity . The forum is really easy to sign up…

www.huge-entity.com turns 365 days old today... Where were you when it all started? The Huge Entity rears back its shaggy maine of nonsense clod fur, cracks wide a pair of blood speckled jaws and lets the universe know its power; truly alive where once t'was…

This video interview with Arab-American psychologist Wafa Sultan was aired on Al Jazeera last week - its emphatic message still echoes through my mind as I type this, her passion is intoxicating: The clash we are witnessing around the world is not a clash of…

In prose nor dialectic, equality you'll find, but semantic perspiration, of testosteron-ic kinds. Today's sceptical enquiries, their beauty will astound, an inner neutral wonder, in Haiku can be found. But please whilst idly glancing, debating inner…

The giant spiral disk of stars, dust and gas is 170,000 light-years across or nearly twice the diameter of our Milky Way. The galaxy is estimated to contain at least one trillion stars. Approximately 100 billion of these stars alone might be like our Sun in…

UPDATE: The Circle has been posted: Go here... Message to sceptics: I claimed you didn't exist , Prove me wrong Thursday! Now accepting submissions to The 29th Meeting of The Skeptics' Circle . Please send me links to articles of sceptical origin, whether…

I was struck today by news that a rare genetic defect seems to be turning back the evolutionary clock in humans . The similarities between people carrying the defective gene and a certain, ape-descended, politician are quite astounding. See what you think:…

"Oil is an organic material - every organic thing on our planet will be oil in future... It's like life after death." Russian artist Andrei Molodkin Via BBC News

The Book: Know : Encounter : Own "My books and stories are intellectual and conceptual mazes. I am in an intellectual maze in trying to figure out our situation (who we are and how we look into the world, and world as illusion, etc.), because the situation is…

The day of the Anthropomorphic - Machine has ended . Welcome to the Era of Slime - Mould - Mechanization ! Via New Scientist & The Nonist !

A Huge Entity presentation on the nature of identity... Featuring short musings from the most original minds in the blogsphere. Contents 1 2B ll ~ 2B by Cutie Programmer 2 Living in a Multiverse by Reality Carnival 3 The Tipping Point by BPS Digest /…

In our semantically governed, symbolic understanding of reality we often maintain that true -identity is possible, that the whirling sensations called 'you' somehow cease at the surface of your skin, all else being distinct. Of course the Buddhist conception…

Some news stories are more prophetic than others: US plans to 'fight the net' revealed Rumsfeld's Roadmap to Propaganda Climate expert says NASA tried to silence him

Is the future of humanity in the hands of Russian capitalism? From the ever contemplative DunneIV : RUSSIA is planning to mine a rare fuel on the moon by 2020 with a permanent base and a heavy-cargo transport link, a Russian space official says. "We are…

Body, volume, style and shine with long-lasting power. Clonycavan Styling Gel, along with mummification in Irish peat, works together with your freshly disemboweled corpse to protect hair from the disruptive power of 2000 years of rigor-mortis. Whether the…

Vyvyan: Do you think ants go to discos? Mike: Vyvyan - it has been proved that ants are highly intelligent with a well ordered society - the last thing they'd go to would be discos. Vyvyan: Well, why's one of them wearing a silver boob tube then? The Young…

'String Theory' posits that our universe arises from the vibrations of tiny, infinitesimal and multi-dimensional strings of energy resonating in a higher dimension of reality. A beautiful, if complicated idea resting on the very tip of the physics…

The world is a reflection, cast by the remnants of light photons scattered onto the only point where your brain makes physical contact with the outside world: your eyes. Yet with such abundance of reality mirroring humans still find the concept of reflection…

From All Communist Super-Leaders Everywhere! (and The Huge Entity )

'According to a recent study, women are aroused by watching monkey sex. Sure, they're more aroused by watching human sex, but the loving habits of the bonobo are enough to bring out the primate in any civilized lady... Barbara Bartlik, a psychiatry professor…

"Nasa has estimated that an impact from [asteroid] Apophis, which has an outside chance of hitting the Earth in 2036, would release more than 100,000 times the energy released in the nuclear blast over Hiroshima. Thousands of square kilometres would be…

Words we all know at some level, but just how close to the truth are they? Metaphor, it seems, is always just a step ahead: "The University of Pavia found a brain chemical was likely to be responsible for the first flush of love. Researchers said raised…

...Baudrillard expanded on his theme. "We say that Disneyland is not, of course, the sanctuary of the imagination, but Disneyland as hyperreal world masks the fact that all America is hyperreal, all America is Disneyland," he said. "And the same for art. The…

Links: News Story / Madeyouthink Bonus: Bush baffled by door technology

It's time for evolution to gets her own back! For far too long she has waited patiently as trillion upon trillions of random mutations forced her Darwinian hand. This time mutation ain't getting a look in, 'cos this time it's personal! Inspired by this story…

"Through the British-based Catholic Truth Society, U.S. Jesuit Brother Guy Consolmagno has penned his response to what he says are questions he gets from the public "all the time" when he gives talks on his work with the Vatican Observatory. Titled…

"UC Berkeley physics professor, Raphael Bousso, is trying to break down the mysteries of the universe with a concept called the holographic principle. Physicists stumbled on the idea while studying black holes. It is a concept, which ultimately questions…

Yes, it's Mu Haiku time again at The Huge Entity ! Get your brains at the ready and your contemplative consciousnesses engaged. A real nonsense splitter today: "The US state of Kansas has ruled that science classes in public schools should include the…

This is great. Perspective-Shift-Ahoy! "In 1741, a Danish-Norwegian missionary named Hans Egede published what became a famous account of "a most dreadful monster" that appeared off the coast of Greenland. "The case is interesting," the modern scientists…

"VATICAN CITY - A Vatican cardinal said Thursday the faithful should listen to what secular modern science has to offer, warning that religion risks turning into "fundamentalism" if it ignores scientific reason. Cardinal Paul Poupard, who heads the Pontifical…

"Ideas that could further exploration in space are coming from a surprising source - animals such as ants, fish and squirrels. The future of space exploration could lie in biomimetics, where engineering meets biology. In effect, it steals nature's…

Been meaning to blog this for a while... Agathidium bushi , Agathidium cheneyi , and Agathidium rumsfeldi - three recently discovered species of slime-mold beetle - got their names from obvious members of the US government in a bout of headline grabbing…

In response to the increasingly popular pursuit of offering reward money for the proof or verification of every theory/belief/idea in the cosmos I have decided to introduce the very first: Huge Entity 'Can you Prove Religious Superiority?' Competition! I will…

As you may have noticed I have seriously overhauled my blog's design. Where once resided a dodo of the blogging world - incredibly unique, yet clumsy looking; a creature destined to go extinct - you will now find something akin to a duck-billed platypus -…

Japan's recent announcement to send noodles where no noodles have gone before surely means the future of noodle technology is looking bright. But what of the past? Step in, The Origin of Noodles , courtesy of the BBC: "The remains of the world's oldest…

"George Bush has claimed he was on a mission from God when he launched the invasions of Afghanistan and Iraq, according to a senior Palestinian politician in an interview to be broadcast by the BBC later this month. ...Nabil Shaath, who was Palestinian…

The future of technology seems bright. We live in a world where 'progress' is perceived as a defining feature of what makes humans different from the rest of the animal kingdom, but what does that word mean? Where are we moving from and what are we moving to?…

"According to Mr. Bernard (see diagram) our world is hollow, with the crust of the earth being 800 miles thick. There exists two openings at the North and South Pole, each hole having a circumference of 1400 miles wide. At the center of the earth is not a…

It's official: According to Google this is The ' top blog ' devoted to Huge -ness in the blogsphere! Only thing left now is to take over the world. You heard it here first...

The debate on Intelligent Design vs Evolution has been flooding through the blogsphere like some cleverly conceived primeval super-goo this week. Screw what I have to say on the issue, what about the rest of the world? HAVE you ever really looked at…

Intelligent Design's last chance has come: In a court of law: "The opening shots were fired on Monday in the first court trial to scrutinise the Intelligent Design movement. ID proposes that life is so complex it cannot have emerged without the guidance of an…

Space might be the final frontier, but these days one is more likely to hear about new advances in food technology over men, moons and the NASA spaceships that get them there. The public seem to have lost their fascination with all things not of the terra…

"It's one thing to have a beer after work or while you're watching TV. But for at least 33 million people in Japan, that is not nearly enough. In fact, many of them are full-blown alcoholics, a survey suggests. And about 70 percent of those overimbibers are…

"Chinese and American people see the world differently - literally. While Americans focus on the central objects of photographs, Chinese individuals pay more attention to the image as a whole, according to psychologists at the University of Michigan, in Ann…

There is a new world religion in town and it's proponents think it could one day rival even Christianity in its popularity and explanatory power. It is thus: The Universe was created by a Flying Spaghetti Monster and all evidence pointing towards evolution…

"We present a class of curved-spacetime vacuum solutions which develop closed timelike curves at some particular moment. We then use these vacuum solutions to construct a time-machine model. The causality violation occurs inside an empty torus, which…

It's 50 years from now and your oldest son is busy trying to set up the new Quantium 8 powered home computer ( bum bum bum bum... ) without getting in a Quantum entanglement. You watch from the sidelines, not pretending for a millisecond to understand the new…

The Solar System got a little bit bigger last month when an elusive Tenth planet was discovered . Bigger and colder than Pluto it's the largest object yet found in our solar system's icy asteroid layer , the Kuiper Belt , and could well be the first in a long…

My family arrive in Japan today, let's hope our genetically similar sweat can collectively reduce the temperature of this god-forsaken country. For those 2 people who read this blog on a regular basis I apologise as family comes before nonsense spurting. My…

History is written by the winners. It has and probably always will be that way. Allied attrocities in World War II most definitely happened, but they are seldom mentioned amongst the lists and lists of activities we can find for the enemy (Germany, Japan…

NEW LINKS SECTION! Del.icio.us Links updated daily... Go and browse

Some positive posting today: The risks of human prosperity: and some ways to avoid them... Climate change: Human designed organisms that can convert excess C02 in the atmosphere into biopolymers and new products - link & The real benefits of Carbon Trading -…

Sick to the back teeth of hearing about boy wizards and an enormously rich British woman? Here's my top 3 things to do other than read/talk about/consume/summon Satan with/throw off a cliff the new Harry Potter book : 1. Read 2. something 3. else...

Following from yesterday's post about the TED conference one of its members, Barry Schwartz, suggests that we all slow the **** down! "It is such a deeply embedded assumption that no one questions it, said Mr Schwartz, who explored the idea in his book, The…

Some big thinkers got together this week at the annual TED Global conference to figure out some stuff. You know the kind of thing 'big' thinkers grapple with don't you? The future; the moral implications of new technologies; reality and all that jazz. Famous…

I awoke this morning to news that raids had been carried out in houses across West Yorkshire in the UK. The suspects, who now appear to have carried out suicide bomb attacks on London, were British citizens: "Detectives now believe the London bombings were…

UPDATE: G8 is over and so, it seems, is any prospect of a Global agreement on environmental issues: 'Global warming is a “serious long-term challenge” requiring“resolve and urgency”, declared the Group of Eight countries on Friday... ...Simon Retallack at the…

UPDATE: "NASA's Deep Impact may fail to live up to its billing as the first mission to look inside a comet. Computer processing designed to correct the spacecraft's defocused camera cannot fully correct the images taken just after impact. If the situation…

Now that the fanfare of Live 8 has subsided those crazy G8 summit members can get right down to the business of saving the world. But maybe in amongst the expensive dinners and fancy cocktails they might reflect on what is, for all intents and purposes, the…

UPDATE: The internet is awash with news of this tremendous day in human exploration. New Scientist , as always, delivers all the info in an easily digestable format. And yes, even they used my all-time favourite science-news cliche : 'However, it will take…

Following my post last week about the infinity of Pi / π , the record for reciting its infinite sequence of numbers from memory has been broken, by a Japanese mental health counsellor no less! According to the BBC News website: "Akira Haraguchi, 59, managed…

"In a special collection of articles published beginning 1 July 2005, Science Magazine and its online companion sites celebrate the journal's 125th anniversary with a look forward -- at the most compelling puzzles and questions facing scientists today." Are…

Click around for more ...

"For decades, the cognitive and neural sciences have treated mental processes as though they involved passing discrete packets of information in a strictly feed-forward fashion from one cognitive module to the next or in a string of individuated binary…

UPDATE: Ha, ha. Maybe you think I get up to a bit of religious and political tom-foolery here at The Huge Entity ? Maybe you'd have my opinionated rantings judged by the Ginger Father Himself (check the story below)? But I believe there is no need for…

I just had to post this... A new, updated Teddy Ruxpin toy is apparently being released this year which "will use digital cartridges containing animation and audio"! I never had one of these robotic insanity inducers, but I do have memories of battling with…

AAAARRRRRGGGGH!! '"I think about Iraq every day. Every single day, because I understand we have kids in harm's way," the president said at a White House news conference. "We will complete the mission and the world will be better off for it."... "We will…

Ever wondered how best to make a fitting tribute to a legendary science fiction author? "Do androids really dream of electric sheep? Now you can ask P. K. Dick himself. This bust relies on 36 servomotors to mimic the sci-fi legend's facial expressions, and…

This story makes fiction seem pointless... "BOSTON - On April 25, Gregory Despres arrived at the U.S.-Canadian border crossing at Calais, Maine, carrying a homemade sword, a hatchet, a knife, brass knuckles and a chain saw stained with what appeared to be…

Wow, this link really needs to be seen to be believed. I knew Japan was unpopular throughout much of Asia (check out this post to get a better idea how much) but when Korean school children use their school project to aim venom at their closest neighbour,…

I have recently become annoyed by the media onslaught of statistics we, as the general public, have to face on a day to day basis. It is a well rounded cliche that you can say anything you like with the right slant on the wrong statistic, but the main issue…

"A Kansas City abortionist is out of business after investigators discovered a grisly house of horrors at his clinic – with fetuses kept in Styrofoam cups in his refrigerator and one employee accusing him of microwaving one and stirring it into his lunch....…

UPDATE: Yes, we all know Michael is free, and most of us knew all along that it was unlikely he was even capable of child molestation, but I have to admit that my conviction in Michael's innocence was not 100% absolute. The trials portrayal by the media is a…

"US Defence Secretary Donald Rumsfeld has told the BBC his country needs to do a "better job" at communicating its policies to the rest of the world. "I think the US is notably unskilful in our communications and our public diplomacy," he said in Washington.…

UPDATE: BoingBoing posts a link to an LA Times piece about Romero and his illustrious, flesh eating career. Check it out here ... In an alternate reality where evil's reign over humanity knows no bounds the doors of hell have burst open, and the dead are left…

Now this , is rather cool: "Sandia National Labs has accelerated a small plate from zero to 76,000 mph in less than a second. The speed of the thrust was a new record for Sandia's Z Machine - sometimes referred to as the fastest gun in the West. Actually the…

I just heard some amazing news. One of my best mates and his sister are in a band called The Demon Barbers , a manic blend of traditional folk music with an eclectic modern, and indisputably, British spin. Well not only is there new studio album "Waxed" to be…

"Gay Fuel is pasteurized, has a great fruit flavor, is slightly carbonated and overcomes other energy drinks’ artificial taste. With the energetic goal of creating a superior product, Gay Fuel was formulated using the highest quality ingredients, such as real…

Following from Friday's post on scientist's attempts to build a computer model of the Universe I came upon this New Scientist post about building a computer simulation of the Human brain: "An effort to create the first computer simulation of the entire human…

"Scientists have recreated a vast segment of the universe inside a computer and written a brief history of time, black holes and galaxy formation. The Millennium Simulation - the biggest exercise of its kind - required 25 million megabytes of memory. But it…

Back from the brink... Today, since my entire body feels as if it has been surgically removed and replaced with a box of horse shit I thought I'd save the world of internet surfing for all you lovely folk. Here are some interesting links for you to check out:…

"An article published in the latest issue of Diplomatic History examines Bush’s post 9/11 national security strategy in a historical perspective. In doing so, author Melvyn P. Leffler finds that there is nothing new or revolutionary about the Bush…

Yes. I travel North today. First to Osaka, then Aichi for the World Science Expo 2005, and then Kobe for a bloody JET conference. May my trip bring many photos of huge, bad ass robots. Watch this space!

News direct from the BBC website suggests that video gaming could be about to move in a new, exciting direction, well, that's as long as the Christian gaming community have anything to do with it: "The Devil, they say, has all the best tunes. Until now he has…

"A pre-kindergartner who included God on his list of 'favorite things' has been expelled from his California school for breaching the wall between church and state. School officials say that three-year old Jacob Sapperstein can return to school next week,…

With all the uproar about religion & state, atheism & creationism, darwinism & design going on at the moment I thought I'd bring attention to what is one of my biggest sore points... Religion! Yeah that's right. Religion as a whole. That majority of…

"The report from the 911 Commission sited a "lack of imagination" as a reason that the World Trade Center hijack/attack was not averted." So in November 2004 Cockeyed asked his site's readers to come up with as many 'creative' terrorist attacks as possible.…

Two, almost unrelated stories today: The shortness of skirts for School girls in Okinawa : ""When I've been walking through the streets recently, I've been stunned by the growing number of girls wearing incredibly short skirts. I don't know where to turn my…

"As a protest against the U.S. war in Iraq, Eric Wallach staged his own crucifixion at the Astor Pl. traffic triangle at Lafayette St. To crucify himself Wallach climbed on top of a crossing-signal sign and hung there about two hours. Passersby snapped…

UPDATE: More exciting Nintendo possibilities outlined by the BoingBoing weblog: "Nintendo promises a console that will run anyone's code? Hidden in a fluffy press release for Nintendo's new Revolution console device is this notice: 'Freedom of design: A…

Following recent news that UK Parliament plans to outlaw 'incitement to religious hatred' , isn't it about time that we start being more nice about religion for a change?

"Recently released Health, Labor and Welfare Ministry statistics, which show 32 percent of married couples in Japan tend to be sexless, has sparked controversy over the definition of the term, rather than the figure itself... ...Of the 8,766 respondents [to a…

The top 3 ways to lose hope in quality science fiction cinema just in time for the summer season: Watch the badly conceived movie version of that most beloved of books, The Hitchhiker's Guide to the Galaxy (find my comments on this awful spectacle in the…

"When Google announced a 10-year, $200 million plan to digitize the literary world, invoking the assistance of Harvard, Stanford, Oxford, Michigan University, and the New York Public Library, France's National Library president Jean-Noel Jeanneney spun around…

Tony Blair (right) and Monty Python's Conrad Poohs (left) bear a striking resemblance don't you think? Politics and comedy, completely interchangeable. Wipe that smile off your face...

"The Power of Nightmares explains how Curtis believes the vision of an Islamic terror network has been distorted by politicians intent on creating a climate of fear. The film makes it clear there are fanatical individuals willing to conduct acts of terror,…

"Japan's ruling party is pursuing drastic revisions to the country's constitution, including rewording the guarantee of gender equality. Women's rights advocates say that if the revisions pass, Japan will return to "a dark period of history." The…

Two superb links today. I have noticed recently a thriving online community devoted to Lego engineering projects. Everything from an A-Team Van replica to a fully working Rubic's cube have passed my gaze. Today though I found the bees knees in design. A fully…

So I took down the post. There were several reasons, the main one being that deep down I am too much of a cynic about everything to be against any specific ignorance. Someone pointed out to me that ignorance is also subjective. I didn't want to end up…

"Radar has helped resolve a long-standing controversy about the purpose of a strange dance performed by bees, Nature magazine reports. The famous "waggle" dance contains information about the whereabouts of nectar, just as was originally proposed in the…

Nurses around Japan will now be able to revel in the ability to practice their wares on a lifesize, fully poseable, Obaachan (old woman) doll. I say do with this doll what you like, but there are some inherent problems here - I just can't seem to take my eyes…

Following on from yesterday's story on political and religious ignorance here are two related stories from Slate (online news source): Creationism vs. Intelligent Design: Is there a difference? - Link Conservatism As Pathology: Are Bush supporters literally…

UPDATE: Here "Do you believe God belongs in government? Do you believe President Bush is doing The Lord's Work? If so, then show your love for God & the USA!" These words are from the awful website www.bushfish.org and they symbolise everything I despise…

Did North Korea recently fire a short-range missile toward the Sea of Japan? Will holding a time-traveler convention tempt real time-travelers to turn up? Did David Hasselhoff help end the cold war? Do people need help to pluck up the courage to have an orgy?…

"Experts have dated the UK's oldest rock art, at Creswell Crags in the midlands, to more than 12,800 years ago... The complex of caves at Creswell Crags has preserved evidence of human activity during the last Ice Age. " "The man in charge of the Hubble space…

"Almost one-third of Japan's married couples are sexless, with about 20 percent of unions bereft of physical intimacy for one year or more, an alarming poll conducted by the Ministry of Health, Labor and Welfare and the Japan Family Planning Association…

True perceived reality is a nonsense. In this mass produced, mass perceived world we inhabit one is often brought to the deceptive conclusion that we live on the brink of some progressive, maybe final understanding; a wave of truth about to sweep our modern…

Coming Anarchy has posted a selection of interesting screenshots taken from Japanese TV. The shots show opinions on Japan as cast by representatives from all of Japan's major Asian Neighbours. Bear in mind that this is Japanese TV we're talking about here,…

Update: "Chinese President Hu Jintao has urged Japan to "seriously reflect" on its wartime history and back up government apologies with action." - Link ...and also this interesting BBC article popped up: "Young Chinese are taught about the atrocities…

Yes, that's right. Ratzinger is now the official ruler of over 1 billion Catholics and the supposed representative of God TM on Earth. Let's all rejoice as conservative views continue to rule: Opposition to abortion Opposition to Homosexuality Opposition to…

Huge Entity favourite and infamously conservative Roman Catholic, Cardinal Joseph Ratzinger, crosses his fingers this week as voting starts for the election of the new Pope TM . But as many conservative Catholics rally for Ratzinger's cause questions are…

"TOKYO: Officially pacifist Japan in 1994 studied the possibility of a pre-emptive attack on North Korea amid fears of a missile launch, even though it lacked the military capability, an official and a report said Friday. The Sankei Shimbun said the Defense…

"The Chinese and Japanese foreign ministers are holding crisis talks in Beijing over a wave of anti-Japanese protests across China. Japanese Foreign Minister Nobutaka Machimura is seeking an apology for the protests, but China has said the real issue is…

"Thousands of people have taken to the streets of the Chinese city of Shanghai in the latest in a series of anti-Japanese demonstrations. Protesters, shouting anti-Japanese slogans and carrying Chinese flags, threw eggs and plastic water bottles at the…