I have a terrible tendency to read several books simultaneously, causing much mental overlap and leaving the floor of my room a constant litter of half-read compendiums. At the moment, the book which has most prominently grabbed my imagination is Michael…

Where does technology end and our idea of God begin? Human beings evolved to perceive a distinction between 'ourselves' and 'our technology'. Increasingly though, our technological achievements are becoming extensions of our bodies, our identities and our…

A "data cable" made from stretched nerve cells could someday help connect computers to the human nervous system. The modified cells should form better connections with human tissue than the metal electrodes currently used for purposes such as remotely…

The Manipulator Photography by Jill Greenberg

Bert Myers' hauntingly beautiful X-Ray Photography Via NotCot.org !

With giant Saturn hanging in the blackness and sheltering Cassini from the sun's blinding glare, the [Cassini-Huygens] spacecraft viewed the rings as never before, revealing previously unknown faint rings and even glimpsing its home world. This marvelous…

Keep clear of the cat if you want baby girls. It sounds like the lamest of old wives' tales, but according to scientists women infected with a common cat parasite give birth to more sons than daughters. The parasite, toxoplasma, infects around 15% of Britons,…

The brain: that gathered walnut of grey matter, lodged inconspicuously in the skull cavity of each and every one of us. Peer deep enough into these zones of thought; feeling; memory; dreams and each tiny pulse of inherent beauty appears as nothing more than…

George Dyson asks: Are we learning to manipulate life or is life learning to manipulate us? A plausible scenario for how we arrived at life as we know it is that primitive organisms were infected by self-replicating parasites, learned to adopt those…

In the past, both big and small entities have graced The Huge Entity front page. Today we will encounter the largest single object in our galactic neighbourhood - Introducing, The Sun : Now I got you slavering at the mouth for masses of hot, fiery gas, try…

Via Metafilter!

Next time you go for the proverbial dump consider the process involved in turning one plate of badly cooked meat and veg into a self perceiving, website reading, procrastinating you . It occurs to me that the chance of atoms, manufactured billions of years…

GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGCT TGGGGTTCACCTCTAATTCTAAGATGGCTAGATAATGCATCTTTCAGGGTTG TCTAGAA WHATAPIECEOFWORKISMAN AAAAGTCCTCAAGAGGTTGGTTAAT GTTTAATAGTACAGTATGGTGACTATAGTCAACAATAATTTATTGTACATTTTT…

The universe is at least 986 billion years older than physicists thought and is probably much older still, according to a radical new theory. The revolutionary study suggests that time did not begin with the big bang 14 billion years ago. This mammoth…

Aliens! Wide-eyed, short-statured, extraterrestrially-elongated aliens! In a universe as vast as this one (assuming you aren't one of those un-evolved creationist types) alien life of some form or other appears to be a statistical certainty. Yet, in an…

"With respect to the theological view of the question. This is always painful to me. I am bewildered. I had no intention to write atheistically. But I own that I cannot see as plainly as others do, and as I should wish to do, evidence of design and…

"There's a paradox,"said Kevin White, a geneticist at Yale. "The sequences of the genomes between humans and chimps are so similar; so the genes encoded in the two genomes are so similar to one another. Yet, you have very rapid divergence in morphology and…

In humans, intelligence develops over time. A child learns primarily from the guidance of patient adults. Without strong social--that is, cultural--inputs, even a potential wunderkind will end up a bungling bumpkin as an adult. We now have evidence that this…

Via Reality Carnival !

Rejoice! For the 3rd month, 14th day, 1st hour, 59 th minute, and 26th second (3.1415926) of this year has past us by.... What does it all mean? Happy π day ! At the simplest level Pi ( π ) is the ratio of the circumference of a circle to its diameter, and at…

In the spirit of maintaining a balanced universe here are some Excruciatingly Small Things - Fractal constellations erupting from the humble Petri-dish... Bacteria , it must be said, are simple, fascinating and make up the vast majority of the Earth's…

I was struck today by news that a rare genetic defect seems to be turning back the evolutionary clock in humans . The similarities between people carrying the defective gene and a certain, ape-descended, politician are quite astounding. See what you think:…

In our semantically governed, symbolic understanding of reality we often maintain that true -identity is possible, that the whirling sensations called 'you' somehow cease at the surface of your skin, all else being distinct. Of course the Buddhist conception…

The Huge Entity never shies away from the raw, sexual power exhibited by hermaphroditic animalia . And so today, in true excruciating form, I present to you: Penis-Fencing Flatworms There is a high probability that at least one person who reads this has been,…

"The fairest thing we can experience is the mysterious. It is the fundamental emotion which stands at the cradle of true art and true science. He who knows it not and can no longer wonder, no longer feel amazement, is as good as dead, a snuffed-out candle. It…

Vyvyan: Do you think ants go to discos? Mike: Vyvyan - it has been proved that ants are highly intelligent with a well ordered society - the last thing they'd go to would be discos. Vyvyan: Well, why's one of them wearing a silver boob tube then? The Young…

'String Theory' posits that our universe arises from the vibrations of tiny, infinitesimal and multi-dimensional strings of energy resonating in a higher dimension of reality. A beautiful, if complicated idea resting on the very tip of the physics…

The world is a reflection, cast by the remnants of light photons scattered onto the only point where your brain makes physical contact with the outside world: your eyes. Yet with such abundance of reality mirroring humans still find the concept of reflection…

Name: The Termite Colony Origin: Isoptera Order - 200,000,000 years old Biography: Subterranean termites are ground-inhabiting, social insects that live in colonies of up to 200,000 individuals. The obvious simplicity of these 8mm long individuals is overcome…

'According to a recent study, women are aroused by watching monkey sex. Sure, they're more aroused by watching human sex, but the loving habits of the bonobo are enough to bring out the primate in any civilized lady... Barbara Bartlik, a psychiatry professor…

"Nasa has estimated that an impact from [asteroid] Apophis, which has an outside chance of hitting the Earth in 2036, would release more than 100,000 times the energy released in the nuclear blast over Hiroshima. Thousands of square kilometres would be…

In the world of TV nature documentaries David Attenborough is the ONLY name that'll make 99% of British people foam at the mouth, guaranteed. And he has a new series on the way, which I will miss. Thankfully though I can always head on over and catch some…

It's time for evolution to gets her own back! For far too long she has waited patiently as trillion upon trillions of random mutations forced her Darwinian hand. This time mutation ain't getting a look in, 'cos this time it's personal! Inspired by this story…

"UC Berkeley physics professor, Raphael Bousso, is trying to break down the mysteries of the universe with a concept called the holographic principle. Physicists stumbled on the idea while studying black holes. It is a concept, which ultimately questions…

I remember many years ago someone telling me that there was a recognised term for the kind of involuntary shudder that commonly affects people at rest. You know the kind that spontaneously rocks you, just for a moment, like you are shaking off the ghoulies,…

This is great. Perspective-Shift-Ahoy! "In 1741, a Danish-Norwegian missionary named Hans Egede published what became a famous account of "a most dreadful monster" that appeared off the coast of Greenland. "The case is interesting," the modern scientists…

"Ideas that could further exploration in space are coming from a surprising source - animals such as ants, fish and squirrels. The future of space exploration could lie in biomimetics, where engineering meets biology. In effect, it steals nature's…

Southern Japan revels in their insect devastation. The supermarkets seem to hold host to a wide variety of poisons, traps and sprays designed to cause insects a breakdown in their existence. On a recent shopping trip there amongst the cockroach neutralisers…

Been meaning to blog this for a while... Agathidium bushi , Agathidium cheneyi , and Agathidium rumsfeldi - three recently discovered species of slime-mold beetle - got their names from obvious members of the US government in a bout of headline grabbing…

Some positive posting today: The risks of human prosperity: and some ways to avoid them... Climate change: Human designed organisms that can convert excess C02 in the atmosphere into biopolymers and new products - link & The real benefits of Carbon Trading -…

UPDATE: G8 is over and so, it seems, is any prospect of a Global agreement on environmental issues: 'Global warming is a “serious long-term challenge” requiring“resolve and urgency”, declared the Group of Eight countries on Friday... ...Simon Retallack at the…

Now that the fanfare of Live 8 has subsided those crazy G8 summit members can get right down to the business of saving the world. But maybe in amongst the expensive dinners and fancy cocktails they might reflect on what is, for all intents and purposes, the…

"Radar has helped resolve a long-standing controversy about the purpose of a strange dance performed by bees, Nature magazine reports. The famous "waggle" dance contains information about the whereabouts of nectar, just as was originally proposed in the…

Inspired by the forthcoming Hitchhiker's Guide to the Galaxy movie, and by the simple fact that I've always had a deep rooted desire to carry out this task myself, here is a link discussing the various methods and means of Destroying the Earth . Enjoy